ID: 1173239388

View in Genome Browser
Species Human (GRCh38)
Location 20:41280338-41280360
Sequence CAGTATTTATAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173239379_1173239388 12 Left 1173239379 20:41280303-41280325 CCAATTGCCTGGGCCCCACCGCA No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data
1173239382_1173239388 -2 Left 1173239382 20:41280317-41280339 CCCACCGCAATGCAACTGAATCA No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data
1173239383_1173239388 -3 Left 1173239383 20:41280318-41280340 CCACCGCAATGCAACTGAATCAG No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data
1173239381_1173239388 -1 Left 1173239381 20:41280316-41280338 CCCCACCGCAATGCAACTGAATC No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data
1173239380_1173239388 5 Left 1173239380 20:41280310-41280332 CCTGGGCCCCACCGCAATGCAAC No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data
1173239384_1173239388 -6 Left 1173239384 20:41280321-41280343 CCGCAATGCAACTGAATCAGTAT No data
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173239388 Original CRISPR CAGTATTTATAGAGGGAAGA GGG Intronic
No off target data available for this crispr