ID: 1173239388

View in Genome Browser
Species Human (GRCh38)
Location 20:41280338-41280360
Sequence CAGTATTTATAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 317}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173239382_1173239388 -2 Left 1173239382 20:41280317-41280339 CCCACCGCAATGCAACTGAATCA 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317
1173239383_1173239388 -3 Left 1173239383 20:41280318-41280340 CCACCGCAATGCAACTGAATCAG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317
1173239379_1173239388 12 Left 1173239379 20:41280303-41280325 CCAATTGCCTGGGCCCCACCGCA 0: 1
1: 0
2: 2
3: 14
4: 151
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317
1173239380_1173239388 5 Left 1173239380 20:41280310-41280332 CCTGGGCCCCACCGCAATGCAAC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317
1173239381_1173239388 -1 Left 1173239381 20:41280316-41280338 CCCCACCGCAATGCAACTGAATC 0: 1
1: 1
2: 1
3: 11
4: 136
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317
1173239384_1173239388 -6 Left 1173239384 20:41280321-41280343 CCGCAATGCAACTGAATCAGTAT 0: 1
1: 0
2: 1
3: 24
4: 239
Right 1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173239388 Original CRISPR CAGTATTTATAGAGGGAAGA GGG Intronic
900781241 1:4618437-4618459 GACAATTTATAGAGGGAAGCAGG + Intergenic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906006087 1:42471796-42471818 CAGTATTTATAGATGATAAATGG - Intronic
907345836 1:53779298-53779320 CAGTTTTTATATCTGGAAGATGG - Intronic
908768896 1:67577997-67578019 CAACTTCTATAGAGGGAAGAGGG + Intergenic
908813728 1:68010594-68010616 ACGTATTTATTGAGGGAAAAAGG - Intergenic
909303432 1:74042365-74042387 GAGTATTTATAGATAGAAAATGG + Intronic
909891245 1:81009859-81009881 AGGAATTTATAGAAGGAAGATGG + Intergenic
910698369 1:90046138-90046160 CAGTTTTTATAGTGGGAAGCAGG + Intergenic
911504531 1:98732345-98732367 CAGTATTTATAGGGGAAAAGTGG + Intronic
912118291 1:106435406-106435428 CAGTATTTGTAGACAGAAAAAGG + Intergenic
913583086 1:120246364-120246386 CAGAATCTATTGAGGGAAGCAGG - Intergenic
913625086 1:120651996-120652018 CAGAATCTATTGAGGGAAGCAGG + Intergenic
914565074 1:148858182-148858204 CAGAATCTATTGAGGGAAGCAGG - Intronic
914607750 1:149272060-149272082 CAGAATCTATTGAGGGAAGCAGG + Intergenic
915746994 1:158169288-158169310 CAGTATTTATAGAAAGAAAAAGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
919630668 1:199957406-199957428 CAGTAATAATATAGAGAAGAAGG - Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
923804929 1:237247442-237247464 CAGTAACTATAGGGCGAAGAAGG + Intronic
924393720 1:243593042-243593064 CAGTTTTTATTGTGGGATGACGG - Intronic
1063913827 10:10860720-10860742 CAGTATTTATAGATAGGAAAAGG + Intergenic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064814806 10:19247949-19247971 CAGTATTTGTAGACAGAAAAAGG + Intronic
1065130323 10:22613493-22613515 CAGAACTGATGGAGGGAAGATGG + Intronic
1065598329 10:27340286-27340308 AAGTATTTACAGAGGCAAAAGGG + Intergenic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1068761657 10:60717943-60717965 CAGTATTTATAGACAGAAAAAGG + Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1071590316 10:86866196-86866218 CAGAATCTATAGATAGAAGAGGG + Intronic
1072060150 10:91801796-91801818 CAGAATTTGTAGAGGCAAGTTGG + Intronic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1073861069 10:107741288-107741310 CTATATTTATAGAGGGAAAGAGG + Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1076544437 10:131235392-131235414 CAGCATCTATAAAAGGAAGAGGG + Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079183194 11:18212182-18212204 CATTCTTTATAGCTGGAAGAAGG - Intronic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080870185 11:36230016-36230038 CAGAATTTATACAGGGTAGATGG - Exonic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085759292 11:79227983-79228005 CATTCTTTATTGAGAGAAGAAGG + Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1087745986 11:101947375-101947397 CAATATTTAGAGAGAGAAGTAGG + Intronic
1088127245 11:106443325-106443347 CAATATTTAGACAGGGAAAATGG - Intergenic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091314878 11:134607405-134607427 CAGTTTTTATATCTGGAAGATGG - Intergenic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091923755 12:4327095-4327117 CAGTATTTATAGACAGAGAAAGG + Intronic
1092162435 12:6323362-6323384 CAGTCTTTATACACTGAAGAGGG + Intronic
1092669675 12:10848716-10848738 AAATATTTAAAGAAGGAAGAAGG - Intronic
1093086718 12:14873645-14873667 CAGTATTTATAGACAGAAAAAGG - Intronic
1093836387 12:23834722-23834744 CAGTTCTTAAAGAGGTAAGAAGG + Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1097207308 12:57333713-57333735 AAATATTTCTAGAGGGAAGGAGG + Intronic
1097309064 12:58098881-58098903 GAGTGTTTATAAAGGGAAGCAGG - Intergenic
1098400367 12:70068827-70068849 GAATATTTATAGACAGAAGAAGG + Intergenic
1099757478 12:86871923-86871945 CAGTATTTATAGACAGAATATGG - Intergenic
1099893273 12:88614934-88614956 CAGTATTTATAGGGGTAGCAAGG - Intergenic
1100756983 12:97762127-97762149 CAGTATTTAAAGGGGAAAAATGG - Intergenic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1103163640 12:118751955-118751977 CAGTATCTATCCAGGTAAGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106893045 13:34267111-34267133 CATTATTTATAGATAGAAAAAGG + Intergenic
1107239981 13:38221309-38221331 CAGTATTTATAGTCAGAAAAAGG + Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108086430 13:46797686-46797708 TAATTTTTATTGAGGGAAGAAGG - Intergenic
1109169926 13:59082650-59082672 CAGGATTTATACAATGAAGATGG + Intergenic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1111081025 13:83308066-83308088 CAGTACTTTTAGAAGGAAGCTGG - Intergenic
1111315041 13:86544586-86544608 CAGTATTTATAGACAGAAAAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112687585 13:101849228-101849250 CAGCATTTAGAGTGGGAAAAGGG + Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1116975231 14:51108575-51108597 CAGGATCTAAAGAGGGAAAAGGG + Intergenic
1119353151 14:73982962-73982984 AAGTATTCATATAGGGAAAAGGG + Intronic
1120278767 14:82412027-82412049 TAGTATCTATACAGAGAAGAGGG - Intergenic
1120282000 14:82451072-82451094 AAGTATTTATAGACAGAAAATGG + Intergenic
1120682246 14:87494256-87494278 CAGTATTTACAGACAGAAAAAGG - Intergenic
1121486480 14:94320479-94320501 CAGTATTTACAGGCAGAAGAAGG - Intronic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122164072 14:99807988-99808010 CAGTATTTAAATACGGAAAAAGG - Intronic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474606 14:101998302-101998324 CAGCTCTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474623 14:101998396-101998418 CAGCATTTATAAAGGGGAGAGGG - Intronic
1123412182 15:20069728-20069750 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1123521526 15:21076848-21076870 CAGTCATTATTCAGGGAAGAGGG + Intergenic
1124002341 15:25769859-25769881 CAGTTTTTAAAGAGGTAATAAGG + Intronic
1125853598 15:42927580-42927602 TAATATTTACAGAGTGAAGAAGG - Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1131773124 15:95762766-95762788 TAGTATTAATAGAGAGGAGATGG - Intergenic
1132024412 15:98392647-98392669 CAGTTTATATAGAGGGGAGTTGG - Intergenic
1132647165 16:1004399-1004421 CAGTATTGATTCAGGGAAGGTGG + Intergenic
1134057025 16:11176880-11176902 CAGCATATAGAAAGGGAAGAGGG - Intronic
1134908919 16:18006400-18006422 TAAGGTTTATAGAGGGAAGAGGG - Intergenic
1134909751 16:18014117-18014139 GAGTATTTATAGACAGAAAATGG - Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137449669 16:48559735-48559757 CAGTATTTATAGGCAGAAAAGGG - Intronic
1138848848 16:60602253-60602275 CATTATGTATAGAGGCAAAAAGG + Intergenic
1140625979 16:76794903-76794925 TAGTTTTTATAGAGACAAGATGG + Intergenic
1140709991 16:77668739-77668761 CAGTTATGATAGAGGAAAGAGGG - Intergenic
1141277247 16:82599593-82599615 CAGCATTTATCTAGGGCAGAGGG + Intergenic
1143845490 17:9770191-9770213 TAATATTTATAGATGAAAGAGGG - Intergenic
1143923973 17:10353153-10353175 CAGTATTTATAGGCAGAAAAAGG - Intronic
1144353094 17:14417610-14417632 CAATATTTGTAGAGAGAAAAAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146741202 17:35285223-35285245 CAGTATTTATAGAAAGAAAAGGG + Intergenic
1146804987 17:35857916-35857938 CAGTATTTTTAGTAGGCAGAAGG + Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1149216982 17:54369156-54369178 CAGTATTTATAGACAGCAAAAGG - Intergenic
1149930132 17:60743555-60743577 CAGTATCTATAGGGGAAAGTGGG + Intronic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1151841553 17:76621802-76621824 CAGTACTTATAGACAGAAAAGGG - Intergenic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1155644364 18:28059557-28059579 CAGTATTTATGGATAGAAAATGG - Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1158435480 18:57432943-57432965 CAATATTGATCGAGGGAAGGCGG + Intergenic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1165972592 19:39644940-39644962 CAGCTCTTATAGAGGGAAAAGGG - Intergenic
1165981266 19:39726382-39726404 CAGTTTTTATCTAGGGATGAGGG - Intergenic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
926457315 2:13082858-13082880 CAAAATTTAAAGAGGAAAGAAGG - Intergenic
926466329 2:13193346-13193368 CAGTATTTATAAACGAAACAAGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928361634 2:30666744-30666766 CAGTATTTACAGATAGAAAAAGG - Intergenic
929667958 2:43848268-43848290 CAGTATTTATAGACAGAAAAAGG + Intronic
929692483 2:44086423-44086445 CATTATTTTTAGAATGAAGAAGG + Intergenic
930788654 2:55299775-55299797 CAGTATTTAAAGGTGGGAGATGG - Intronic
930804461 2:55476460-55476482 CAGGATTTACATAGAGAAGAGGG + Intergenic
931410169 2:62022109-62022131 CAGTTTTTATATAGGGAGTAAGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933294356 2:80472435-80472457 AAGCAATTATAGTGGGAAGATGG + Intronic
933405914 2:81859216-81859238 CACTATTTATAGACAGAAAAAGG - Intergenic
933495485 2:83045518-83045540 GAGTATTTATAGACAGAACATGG - Intergenic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
933868081 2:86542713-86542735 CATTATTTTTAAAGGGAAAAAGG - Intronic
935189765 2:100767551-100767573 CAACAATTACAGAGGGAAGAAGG + Intergenic
935504689 2:103885551-103885573 CAGTATCTAGAGAGGTAAAAGGG + Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
938836926 2:135113633-135113655 CAGCATTTATAGACAGAAAATGG - Intronic
938873715 2:135510564-135510586 CAGGATTTGGAGTGGGAAGAAGG - Intronic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
939908210 2:147945345-147945367 AAGTAATTATAGAAGCAAGAAGG - Intronic
941502828 2:166301412-166301434 GAGTATTTATAGACAGAAAAAGG - Intronic
941610564 2:167656765-167656787 GAGTATTTATTAAGGGAATATGG - Intergenic
941848115 2:170151612-170151634 AAGTATTTATGGAGGAAGGAAGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943049252 2:182895422-182895444 CAATATTTATAGACAGAAAAAGG - Intergenic
943567960 2:189539211-189539233 CAGTATGTATATAGAGAGGAGGG - Intergenic
945026670 2:205626065-205626087 CATTATTTAGAGAGTAAAGAGGG + Intergenic
948220246 2:236263667-236263689 CATTATTTATAGAAGCAAAAAGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1170418228 20:16167103-16167125 CATTATTTATCGAGGTAATAAGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173660824 20:44732263-44732285 CAGTATTTAAAGGGGAAAGCAGG + Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1179968933 21:44823533-44823555 CAGTATTTAAAGAGGAAAAGTGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1182655670 22:31887924-31887946 CATGATTTATAGGGGGAAGAAGG + Intronic
950809181 3:15635014-15635036 TAGTATGGATAGAGGGCAGAGGG + Intronic
952097847 3:29976296-29976318 AAGTACTTAAAGAAGGAAGAAGG - Intronic
952177754 3:30884795-30884817 AAATATTTATTGAGGGAGGAAGG + Intronic
953067872 3:39491232-39491254 CACTGTTTATACAGGGGAGATGG - Intronic
954692091 3:52401051-52401073 CAGTATTTACAGGGGCTAGAGGG + Exonic
955359053 3:58257153-58257175 CAGCACTTAGAGAGGCAAGATGG - Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956031373 3:65041395-65041417 CAGTATTTATAGACAGAGTAAGG - Intergenic
957460983 3:80520389-80520411 CAGTCTTTATACATGGAAAAAGG + Intergenic
958706385 3:97661971-97661993 CAGTATATACTGGGGGAAGAGGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
960465226 3:117989756-117989778 AAATATTTATGGAAGGAAGAAGG + Intergenic
960579045 3:119258136-119258158 GAGTATTTATAGACAGAACAGGG + Intergenic
961151084 3:124638526-124638548 CAGCATTTGTAGAATGAAGAGGG - Intronic
962690415 3:137891277-137891299 TAGGATTTTTATAGGGAAGAGGG + Intergenic
962779109 3:138694460-138694482 CAAAATTTAAAGAGGGAAAAAGG - Intronic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
963923101 3:150924785-150924807 CAGTATTTACAGGAGCAAGAGGG + Intronic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
965085412 3:164089550-164089572 TAGTTTTCATAGAGGAAAGAAGG - Intergenic
965979996 3:174677801-174677823 TAGTATTTCTAGATGCAAGACGG - Intronic
966747625 3:183293232-183293254 GAGTATTTCTAGAGGTAAGGAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967443837 3:189541396-189541418 CAGTATTTATAGTAGAAAAAAGG - Intergenic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
968807588 4:2785802-2785824 CAGTATTTATGGACAGAAAAAGG - Intergenic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
970913348 4:21304911-21304933 CATTATTTATAAAGGATAGAAGG - Intronic
971338226 4:25743932-25743954 TAGAATTTAAAGAGAGAAGAGGG + Intergenic
974651764 4:64763218-64763240 CAGTATTTAAAGGGGAAAGAAGG - Intergenic
975280663 4:72558451-72558473 GAGTCTTTATAAATGGAAGAGGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978048356 4:104163254-104163276 CAGTATTTATAGACAGGAAAAGG + Intergenic
979101029 4:116614496-116614518 CAGTATATATAGAGGTATGTAGG + Intergenic
979337181 4:119476591-119476613 CAGTCATGATAGAGGGATGAAGG - Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979728106 4:123989357-123989379 CAGTATTTATAGACAGACAAAGG - Intergenic
980294649 4:130895992-130896014 CGGTATTTATAGACGGAAAAAGG - Intergenic
980483750 4:133425759-133425781 TAGTATTTATATAGAGAAAAAGG - Intergenic
980972094 4:139576394-139576416 CACTATTTATAGCGGGAGGGGGG + Intronic
981057745 4:140383166-140383188 TTGTATTTATAGCTGGAAGATGG - Exonic
981202440 4:141996613-141996635 CAGCATTTAAAGAGAAAAGATGG + Intergenic
982429901 4:155310911-155310933 CAGTAACTAGAGAGAGAAGAGGG + Intergenic
982551226 4:156802085-156802107 CAGTATTTAAAGGGGAAAGGTGG - Intronic
983468738 4:168128894-168128916 AAGTATATAGAGAGAGAAGAAGG + Intronic
985003471 4:185508723-185508745 ATTTATTTATAAAGGGAAGACGG + Intronic
986444969 5:7813284-7813306 GAATATTTATGGAAGGAAGAGGG + Intronic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
987978795 5:25053028-25053050 CAGTATTTATGGACAGAAAAAGG - Intergenic
988006870 5:25424725-25424747 CAGTATTGCTAGAAGGAAAATGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991412759 5:66361220-66361242 CAGTATTTATGGATAGAAAACGG + Intergenic
991593661 5:68280101-68280123 CAGAATGTGTTGAGGGAAGATGG + Intronic
992932028 5:81657831-81657853 CAGGTTTTTTAGAGGGAAGGAGG + Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996782759 5:127206545-127206567 GAGTGTTTATAGAGGGAAAGCGG + Intergenic
997084463 5:130781645-130781667 GTATATTTATAGAGGGAAGTTGG + Intergenic
999888362 5:155949076-155949098 CAGTATTTAGGAAGAGAAGAAGG - Intronic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1002028510 5:176411864-176411886 CATTCTTTAGAGAGGGAAGCAGG - Intronic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1002980978 6:2137633-2137655 CAGTACTTAAAAAGGGAATATGG - Intronic
1003140309 6:3465917-3465939 TAGTATTTATAGAGGAAAATTGG + Intergenic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1006252466 6:32799415-32799437 CAATATTTATAGAGAGAAAAAGG + Intergenic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1006891093 6:37429526-37429548 CAGTATTTATAGATAGAAAAAGG + Intergenic
1007019949 6:38509451-38509473 CAGTATTTATAAGGTCAAGAAGG - Intronic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1008315635 6:50036755-50036777 AAGTCTTTATAAAAGGAAGATGG + Intergenic
1008348473 6:50458694-50458716 CAGTCTCTATAGTGGGAGGAAGG + Intergenic
1008485587 6:52031414-52031436 CAGCATTTATAGACAGAAAATGG - Intronic
1009619063 6:66048155-66048177 CAGTATTTACAGACAGAAAAAGG - Intergenic
1010505921 6:76659203-76659225 CAATATTTGGAGAGGGAAGTGGG + Intergenic
1011521408 6:88210372-88210394 AATTTTTTATAGTGGGAAGATGG + Intergenic
1011754876 6:90488199-90488221 GAGTATTTACAGAGAGAAAAAGG - Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013090103 6:106892720-106892742 CATTATTTATAGATGGGAGTGGG - Intergenic
1013352950 6:109322295-109322317 CAAGATTTATAGAAGAAAGATGG + Intergenic
1013871795 6:114772227-114772249 GGGTATTTATAAAGGAAAGAAGG - Intergenic
1014544184 6:122713892-122713914 TAATATTTATAGGGGGAAAAGGG - Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016509260 6:144822322-144822344 CATTACCTATAGAGGGAAAAAGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1019058815 6:169241566-169241588 CAGCATTGTTAGAGGGAAGTTGG - Intronic
1019082402 6:169443938-169443960 CATTATTTATAAAAGGAAGATGG + Intergenic
1020760912 7:12267825-12267847 CTCTATTTAAAGGGGGAAGAGGG - Intergenic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1020993746 7:15235066-15235088 CAGAATCTATAGAAAGAAGAGGG - Intronic
1021247347 7:18280148-18280170 CAATATTTAAAGAGGGAATTTGG + Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1023315606 7:38932935-38932957 CAGTATTTATACATGGAATGGGG + Intergenic
1023582656 7:41699554-41699576 AAGTTTTTATTGAGGGTAGAGGG - Intronic
1025930378 7:65988963-65988985 CAGTCATTATTCAGGGAAGAGGG - Intergenic
1026109984 7:67451302-67451324 CCGTATTTCTAGAGGCCAGAGGG + Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027547512 7:79546860-79546882 CAATATTTTTAGAGGAGAGATGG + Intergenic
1027750020 7:82131412-82131434 CAGTATTTATAGACAGACAAAGG - Intronic
1028154680 7:87416336-87416358 CAGTATCTCTATAGGGAAGAAGG - Intronic
1028722518 7:94050015-94050037 GACTATTTATTGAGAGAAGATGG - Intergenic
1028997383 7:97116462-97116484 CAGTATTTATAGACAGAAAAAGG + Intergenic
1029054690 7:97729622-97729644 CATTATTAATATAGGAAAGATGG - Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1036943649 8:13074158-13074180 AAGTCATTATAGAGGGAATACGG - Intergenic
1037986555 8:23294104-23294126 CAGCATTTAGGGAGGGAACAGGG + Intronic
1039792196 8:40884976-40884998 CAGTATTTATAGATCTAGGATGG - Intronic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1040006370 8:42624604-42624626 CAGTAATTTTAAAGGGAAAAGGG - Intergenic
1041305124 8:56449615-56449637 CATTATTTTCAGATGGAAGATGG + Intergenic
1041360950 8:57053528-57053550 CCTTATTTTTAGTGGGAAGATGG + Intergenic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042690264 8:71490548-71490570 CAATATTTATAGAGAAAAGATGG + Intronic
1045035010 8:98170068-98170090 GAGACTTTATAGAGGGAAGGAGG + Intergenic
1045593402 8:103625102-103625124 CAGTGTTTTTAGGGGGAAGGAGG + Intronic
1045798872 8:106078644-106078666 CAGCACTTTTAGAGGCAAGATGG - Intergenic
1046392388 8:113592441-113592463 CAGAATTTAAAATGGGAAGAAGG - Intergenic
1047379060 8:124339392-124339414 CAGTATTTATAGATAGAAAAAGG - Intronic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048946731 8:139455660-139455682 CAGCCTTCATGGAGGGAAGATGG - Intergenic
1050350515 9:4737393-4737415 CAGTATTTATTGGGGGATTAGGG - Intronic
1050615880 9:7401308-7401330 CTGTATTTAAAGAGGAGAGAGGG - Intergenic
1050968850 9:11843163-11843185 CAGTATGTATAGAGGCAAATGGG - Intergenic
1051111772 9:13646894-13646916 CAGTAGTTATACTGGCAAGAAGG - Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1056548452 9:87632482-87632504 CAGTATATATGTAGGGATGAAGG + Intronic
1056548467 9:87632622-87632644 CAGTATATATGTAGGGATGAAGG + Intronic
1056548478 9:87632734-87632756 GAGTATATATGTAGGGAAGAAGG + Intronic
1056548522 9:87633185-87633207 CAGTATATATGTAGGGATGAAGG + Intronic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1058358494 9:104111434-104111456 CAGTATTTATAAAGTTATGATGG + Intronic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059106507 9:111516342-111516364 CAGTGTTTATAGACAGAAAATGG - Intergenic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1186190624 X:7064442-7064464 CAGTATTAATACAGGGAGGTAGG + Intronic
1186656562 X:11618002-11618024 GAGTATTTATAAGGGAAAGAGGG + Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1186758625 X:12700041-12700063 CAGTCTTTACACAGGGCAGAGGG + Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1188407741 X:29832669-29832691 CAGCATTTACAGAGGAAATAAGG - Intronic
1188563792 X:31501202-31501224 CAGTATTTATAGATAGAAAAAGG - Intronic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1189484335 X:41417781-41417803 GATTATTTTTAGAGGAAAGATGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1193747647 X:85301309-85301331 CAGAAATTATAGAGGCCAGAAGG + Intronic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1196188164 X:112766482-112766504 GAGTATTTATAGACAGAAAAAGG - Intergenic
1198305041 X:135373015-135373037 CAGTATTTATGGACAGAAAATGG + Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198925949 X:141795657-141795679 CAGTCTTGATGGAGGCAAGAGGG + Intergenic
1199109710 X:143916372-143916394 GAGTATGTATAGAGGGGTGAGGG - Intergenic
1199546720 X:149013940-149013962 CAGGATTTGTAGAGGGGAGGGGG - Intergenic
1201709058 Y:16969442-16969464 CAGGTTTTATGGAGGTAAGATGG + Intergenic