ID: 1173241005

View in Genome Browser
Species Human (GRCh38)
Location 20:41297267-41297289
Sequence TTCCCCCAATAGGCCTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173240999_1173241005 17 Left 1173240999 20:41297227-41297249 CCAAGTATTGATGATTCAAAACT No data
Right 1173241005 20:41297267-41297289 TTCCCCCAATAGGCCTGAGTTGG No data
1173241002_1173241005 -7 Left 1173241002 20:41297251-41297273 CCAAGGCTAGCCTGTGTTCCCCC No data
Right 1173241005 20:41297267-41297289 TTCCCCCAATAGGCCTGAGTTGG No data
1173240998_1173241005 18 Left 1173240998 20:41297226-41297248 CCCAAGTATTGATGATTCAAAAC No data
Right 1173241005 20:41297267-41297289 TTCCCCCAATAGGCCTGAGTTGG No data
1173241001_1173241005 -6 Left 1173241001 20:41297250-41297272 CCCAAGGCTAGCCTGTGTTCCCC No data
Right 1173241005 20:41297267-41297289 TTCCCCCAATAGGCCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173241005 Original CRISPR TTCCCCCAATAGGCCTGAGT TGG Intronic