ID: 1173245758

View in Genome Browser
Species Human (GRCh38)
Location 20:41336372-41336394
Sequence GAATCACTGTTAGCCTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173245755_1173245758 26 Left 1173245755 20:41336323-41336345 CCTGGGTGAAAGAGCGAGACTCC 0: 308
1: 13283
2: 66726
3: 114210
4: 142343
Right 1173245758 20:41336372-41336394 GAATCACTGTTAGCCTGGCATGG No data
1173245754_1173245758 30 Left 1173245754 20:41336319-41336341 CCAGCCTGGGTGAAAGAGCGAGA 0: 423
1: 23219
2: 118138
3: 162985
4: 166966
Right 1173245758 20:41336372-41336394 GAATCACTGTTAGCCTGGCATGG No data
1173245756_1173245758 5 Left 1173245756 20:41336344-41336366 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1173245758 20:41336372-41336394 GAATCACTGTTAGCCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173245758 Original CRISPR GAATCACTGTTAGCCTGGCA TGG Intergenic
No off target data available for this crispr