ID: 1173246026

View in Genome Browser
Species Human (GRCh38)
Location 20:41338187-41338209
Sequence CAAACAGCTGCCAGTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173246022_1173246026 30 Left 1173246022 20:41338134-41338156 CCAAATTCTGTAAAGAAGGAAGT No data
Right 1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG No data
1173246024_1173246026 6 Left 1173246024 20:41338158-41338180 CCACCTGCATTCTTGGATTAATG No data
Right 1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG No data
1173246025_1173246026 3 Left 1173246025 20:41338161-41338183 CCTGCATTCTTGGATTAATGAAG No data
Right 1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173246026 Original CRISPR CAAACAGCTGCCAGTGATAT AGG Intergenic
No off target data available for this crispr