ID: 1173249351

View in Genome Browser
Species Human (GRCh38)
Location 20:41356570-41356592
Sequence TGATCCATAGGGAAGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249351_1173249362 19 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
1173249351_1173249363 27 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249351_1173249359 3 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249359 20:41356596-41356618 ACAGGGTTAGGCCTCTCCTTAGG No data
1173249351_1173249358 -9 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249358 20:41356584-41356606 TATGGATCAAGTACAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249351 Original CRISPR TGATCCATAGGGAAGGATCA GGG (reversed) Intronic