ID: 1173249356

View in Genome Browser
Species Human (GRCh38)
Location 20:41356581-41356603
Sequence AACCCTGTACTTGATCCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249356_1173249364 24 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249356_1173249359 -8 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249359 20:41356596-41356618 ACAGGGTTAGGCCTCTCCTTAGG No data
1173249356_1173249366 28 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249366 20:41356632-41356654 AGGTACCCTGGCCCCAAGGAGGG No data
1173249356_1173249367 29 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data
1173249356_1173249363 16 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249356_1173249365 27 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249365 20:41356631-41356653 CAGGTACCCTGGCCCCAAGGAGG No data
1173249356_1173249362 8 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249356 Original CRISPR AACCCTGTACTTGATCCATA GGG (reversed) Intronic