ID: 1173249360

View in Genome Browser
Species Human (GRCh38)
Location 20:41356607-41356629
Sequence GTCAACATTGTCCTAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249360_1173249366 2 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249366 20:41356632-41356654 AGGTACCCTGGCCCCAAGGAGGG No data
1173249360_1173249371 13 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG No data
1173249360_1173249364 -2 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249360_1173249363 -10 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249360_1173249365 1 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249365 20:41356631-41356653 CAGGTACCCTGGCCCCAAGGAGG No data
1173249360_1173249374 26 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249360_1173249367 3 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249360 Original CRISPR GTCAACATTGTCCTAAGGAG AGG (reversed) Intronic