ID: 1173249361

View in Genome Browser
Species Human (GRCh38)
Location 20:41356612-41356634
Sequence CCTGAGTCAACATTGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249361_1173249365 -4 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249365 20:41356631-41356653 CAGGTACCCTGGCCCCAAGGAGG No data
1173249361_1173249364 -7 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249361_1173249374 21 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249361_1173249371 8 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG No data
1173249361_1173249366 -3 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249366 20:41356632-41356654 AGGTACCCTGGCCCCAAGGAGGG No data
1173249361_1173249367 -2 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249361 Original CRISPR CCTGAGTCAACATTGTCCTA AGG (reversed) Intronic