ID: 1173249362

View in Genome Browser
Species Human (GRCh38)
Location 20:41356612-41356634
Sequence CCTTAGGACAATGTTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249357_1173249362 7 Left 1173249357 20:41356582-41356604 CCTATGGATCAAGTACAGGGTTA No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
1173249351_1173249362 19 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
1173249352_1173249362 18 Left 1173249352 20:41356571-41356593 CCTGATCCTTCCCTATGGATCAA No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
1173249353_1173249362 12 Left 1173249353 20:41356577-41356599 CCTTCCCTATGGATCAAGTACAG No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
1173249356_1173249362 8 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249362 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249362 Original CRISPR CCTTAGGACAATGTTGACTC AGG Intronic