ID: 1173249363

View in Genome Browser
Species Human (GRCh38)
Location 20:41356620-41356642
Sequence CAATGTTGACTCAGGTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249356_1173249363 16 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249353_1173249363 20 Left 1173249353 20:41356577-41356599 CCTTCCCTATGGATCAAGTACAG No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249357_1173249363 15 Left 1173249357 20:41356582-41356604 CCTATGGATCAAGTACAGGGTTA No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249351_1173249363 27 Left 1173249351 20:41356570-41356592 CCCTGATCCTTCCCTATGGATCA No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249352_1173249363 26 Left 1173249352 20:41356571-41356593 CCTGATCCTTCCCTATGGATCAA No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data
1173249360_1173249363 -10 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249363 20:41356620-41356642 CAATGTTGACTCAGGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249363 Original CRISPR CAATGTTGACTCAGGTACCC TGG Intronic