ID: 1173249364

View in Genome Browser
Species Human (GRCh38)
Location 20:41356628-41356650
Sequence ACTCAGGTACCCTGGCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249357_1173249364 23 Left 1173249357 20:41356582-41356604 CCTATGGATCAAGTACAGGGTTA No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249360_1173249364 -2 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249361_1173249364 -7 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249353_1173249364 28 Left 1173249353 20:41356577-41356599 CCTTCCCTATGGATCAAGTACAG No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data
1173249356_1173249364 24 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249364 20:41356628-41356650 ACTCAGGTACCCTGGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249364 Original CRISPR ACTCAGGTACCCTGGCCCCA AGG Intronic