ID: 1173249367

View in Genome Browser
Species Human (GRCh38)
Location 20:41356633-41356655
Sequence GGTACCCTGGCCCCAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249360_1173249367 3 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data
1173249356_1173249367 29 Left 1173249356 20:41356581-41356603 CCCTATGGATCAAGTACAGGGTT No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data
1173249361_1173249367 -2 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data
1173249357_1173249367 28 Left 1173249357 20:41356582-41356604 CCTATGGATCAAGTACAGGGTTA No data
Right 1173249367 20:41356633-41356655 GGTACCCTGGCCCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249367 Original CRISPR GGTACCCTGGCCCCAAGGAG GGG Intronic