ID: 1173249368

View in Genome Browser
Species Human (GRCh38)
Location 20:41356637-41356659
Sequence GAAGCCCCTCCTTGGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249368_1173249384 17 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249384 20:41356677-41356699 GGACCCCCATCTATGGAGGGGGG No data
1173249368_1173249382 15 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249382 20:41356675-41356697 CAGGACCCCCATCTATGGAGGGG No data
1173249368_1173249374 -4 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249368_1173249380 13 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249380 20:41356673-41356695 CACAGGACCCCCATCTATGGAGG No data
1173249368_1173249381 14 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249381 20:41356674-41356696 ACAGGACCCCCATCTATGGAGGG No data
1173249368_1173249383 16 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249383 20:41356676-41356698 AGGACCCCCATCTATGGAGGGGG No data
1173249368_1173249377 10 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249377 20:41356670-41356692 CCCCACAGGACCCCCATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249368 Original CRISPR GAAGCCCCTCCTTGGGGCCA GGG (reversed) Intronic