ID: 1173249371

View in Genome Browser
Species Human (GRCh38)
Location 20:41356643-41356665
Sequence CCCCAAGGAGGGGCTTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249360_1173249371 13 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG No data
1173249361_1173249371 8 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249371 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249371 Original CRISPR CCCCAAGGAGGGGCTTCCTA TGG Intronic