ID: 1173249374

View in Genome Browser
Species Human (GRCh38)
Location 20:41356656-41356678
Sequence CTTCCTATGGAGATCCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173249369_1173249374 -5 Left 1173249369 20:41356638-41356660 CCTGGCCCCAAGGAGGGGCTTCC No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249370_1173249374 -10 Left 1173249370 20:41356643-41356665 CCCCAAGGAGGGGCTTCCTATGG No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249360_1173249374 26 Left 1173249360 20:41356607-41356629 CCTCTCCTTAGGACAATGTTGAC No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249361_1173249374 21 Left 1173249361 20:41356612-41356634 CCTTAGGACAATGTTGACTCAGG No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data
1173249368_1173249374 -4 Left 1173249368 20:41356637-41356659 CCCTGGCCCCAAGGAGGGGCTTC No data
Right 1173249374 20:41356656-41356678 CTTCCTATGGAGATCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173249374 Original CRISPR CTTCCTATGGAGATCCCCAC AGG Intronic