ID: 1173250546

View in Genome Browser
Species Human (GRCh38)
Location 20:41362194-41362216
Sequence ATGCTGTCTGAGGTTGGACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173250546 Original CRISPR ATGCTGTCTGAGGTTGGACA TGG (reversed) Exonic
900697884 1:4023513-4023535 AAACTGTCTGAGGTTGGCAAAGG - Intergenic
900716113 1:4145454-4145476 ATGCTGTCTGTGGTTGGGCCAGG + Intergenic
900868788 1:5287300-5287322 GTGCAGTCAGAGGTTGGAAAAGG + Intergenic
903334526 1:22616126-22616148 ATGCTGTGTGACCTTGGGCAAGG - Intergenic
907267524 1:53271893-53271915 CTGCTGTGTGGGGTTGGCCAGGG + Intronic
908397651 1:63740884-63740906 ATGCTGCCTGGGGTTGGGGAGGG + Intergenic
908782342 1:67702059-67702081 GTGCTGTGTGACCTTGGACAAGG - Exonic
909903028 1:81161275-81161297 ATGCTGCCTGGGGTTGGGGAAGG - Intergenic
910906575 1:92187836-92187858 TTGTTGTCAGAGGCTGGACACGG + Intergenic
912972203 1:114294042-114294064 TTGCCCTCTGTGGTTGGACAGGG - Intergenic
913025495 1:114833863-114833885 ATGCTGTTTGACCTTTGACATGG + Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
916319823 1:163492024-163492046 ATGCTGTCTGGGGCTGGGGAGGG - Intergenic
916552475 1:165861778-165861800 GTGCTGTCTGACCTTGGACAAGG - Intronic
920234040 1:204491095-204491117 ATGAATTCTGAGGCTGGACATGG + Intronic
922787084 1:228288200-228288222 ATACTGTCTGAGGCAGGACGGGG + Exonic
923103098 1:230833040-230833062 AGGCTGTGTGAGGTTGGGGAGGG - Intergenic
1063916535 10:10888571-10888593 TTGCTGAATGAGGCTGGACAAGG - Intergenic
1064091991 10:12393641-12393663 ATGCTGTGTGAGTTTAGAGATGG + Intronic
1065135154 10:22660178-22660200 ATGCTTACTGAGGACGGACACGG + Intronic
1065382165 10:25101629-25101651 AGCTTGTCTGAGGTTGGACTTGG + Intergenic
1067829736 10:49604324-49604346 ATGCTGTTTGTGGGAGGACAAGG + Intergenic
1068877178 10:62009428-62009450 AAGTTGTCTGAGATAGGACATGG + Intronic
1069843661 10:71355818-71355840 CTGCTGCCTGAGGTGGCACATGG - Intronic
1070509730 10:77149667-77149689 ATGCAGGCTGAGATTGGAGACGG - Intronic
1070650625 10:78233016-78233038 ATGGTGGCTGGGGCTGGACATGG + Intergenic
1070676161 10:78412951-78412973 TTGCTGTGTGACCTTGGACAAGG - Intergenic
1071950367 10:90696986-90697008 CTGGTGTCTGAGGCTGGAGATGG + Intergenic
1072717820 10:97763130-97763152 CTGCTGTCTGGGCTGGGACATGG + Intergenic
1073405868 10:103297412-103297434 ATGGTGTCTGTGGTTTTACAGGG - Intergenic
1074384076 10:113003432-113003454 ATGGTCTCTGAGGTTGGGCTTGG + Intronic
1076428018 10:130381123-130381145 ATGCTGCCTCACCTTGGACATGG + Intergenic
1076731474 10:132441084-132441106 ATGCTGCCTGCGGTGGGACAGGG + Intergenic
1077120559 11:905774-905796 ATGCAGTCTCAGGGTGGAGAAGG + Intronic
1077445199 11:2587554-2587576 ATGCGGTCTGAGGTCGGGCAGGG - Exonic
1078567634 11:12430578-12430600 ATGCTGTGGGGGGTTTGACATGG + Intronic
1079951619 11:26812600-26812622 TTGCTGTATAAGTTTGGACAAGG - Intergenic
1081739678 11:45429916-45429938 ATGCTGTGTGACTTTGGGCAAGG - Intergenic
1083024892 11:59542489-59542511 ATTCTTGCTGAGGGTGGACAAGG - Intergenic
1083793844 11:65003144-65003166 CTACTGTGTGAGCTTGGACAAGG + Intergenic
1083991594 11:66249473-66249495 ATGCTGTCAGTCCTTGGACACGG - Intergenic
1085199233 11:74691758-74691780 AAGGTGGCTGAGGTTGGAAAGGG - Intergenic
1087424744 11:97971941-97971963 ACACTTCCTGAGGTTGGACAGGG - Intergenic
1089090426 11:115869884-115869906 ATGCTGTCTGTGGTAGGCCAGGG + Intergenic
1089099821 11:115952908-115952930 GTGCTGCCTGAAGTTGGAGATGG + Intergenic
1089660796 11:119983730-119983752 ATGCTCCCTGAGGCTGGCCAAGG + Intergenic
1090145385 11:124315987-124316009 ATGCAGTTTGAGGCTGGACATGG + Intergenic
1090207084 11:124891376-124891398 AGGCTGTCTGAGCTGGAACAGGG + Exonic
1091429947 12:425415-425437 ATGGTGTCTGTGGTGGCACAAGG - Intronic
1091847841 12:3670947-3670969 ATACTGACTGAGGATGGGCATGG + Intronic
1094419727 12:30257834-30257856 GTGCTGCCTGAGGTTGGAGGGGG - Intergenic
1095401481 12:41819154-41819176 ATGAGGTCCGAGGCTGGACAGGG - Intergenic
1097966322 12:65585204-65585226 ATTCTGTTTCAGGCTGGACATGG - Intergenic
1098778114 12:74648580-74648602 ATCCTGGCTGAGGTTGAATAAGG + Intergenic
1099363707 12:81741747-81741769 ATGCTCTCTGAGGTCAGGCAGGG - Intronic
1100457314 12:94765084-94765106 GTGGTGTCAGAGGTTGGGCAAGG - Intergenic
1103988923 12:124785318-124785340 GTGGTGTCTGAGAGTGGACAGGG - Intronic
1104434735 12:128747084-128747106 CTGCTGTGTGATTTTGGACATGG - Intergenic
1106321621 13:28644656-28644678 AGGCTGTTTGAGGTTGGCAACGG - Intergenic
1107174804 13:37387985-37388007 ATGCTGTTTGAAGTGGGAAAGGG - Intergenic
1107959527 13:45545814-45545836 TTGCTGGCTGAGATTGAACAAGG - Intronic
1109990152 13:70043773-70043795 ATACTCTCTGATGTTGCACAAGG + Intronic
1111657074 13:91167241-91167263 GTGCTGGCTGAGGTTGGAAGAGG - Intergenic
1112844216 13:103618026-103618048 ATGATTTCTGAGATTGGAAAGGG - Intergenic
1119566905 14:75636505-75636527 ATGCTGGCTGGGCTGGGACATGG + Intronic
1119722707 14:76901892-76901914 ATCCTGACTGAGGTTTGACTAGG - Intergenic
1124369278 15:29094268-29094290 ATGCTGTCAGAGGATGCAAAAGG + Exonic
1125393134 15:39217192-39217214 ATTCAGTATGATGTTGGACACGG - Intergenic
1127140325 15:55969483-55969505 GTGCTGTCTGAAGTTGGAGGAGG - Intronic
1129235093 15:74219008-74219030 GTGCAGTCTGAGGATGGACATGG + Intergenic
1130890371 15:88128414-88128436 GGGCTGTGTGAGGATGGACATGG - Intronic
1130920664 15:88341825-88341847 ATGCTATCTTAGGGTGGATAAGG - Intergenic
1131920120 15:97317463-97317485 ATCTTGTCTGAGGTTGGCCATGG - Intergenic
1133081212 16:3321757-3321779 AAGATATCTGAGGTTGGGCATGG - Intergenic
1138195149 16:55046444-55046466 AAGCTGGCAGAGATTGGACATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1144044903 17:11446656-11446678 ATGGTTTCCCAGGTTGGACATGG - Intronic
1144143125 17:12369518-12369540 ATGCTGACTGTGGTTTCACAAGG - Intergenic
1148285520 17:46387559-46387581 AAGCTGTCAGAGGCTGGGCATGG + Intergenic
1148307683 17:46605159-46605181 AAGCTGTCAGAGGCTGGGCATGG + Intronic
1149216653 17:54362650-54362672 ATGCTGCCTGAGATTTTACAAGG - Intergenic
1150962259 17:69926905-69926927 ATGGTGACTTAGGATGGACATGG + Intergenic
1152941675 17:83176042-83176064 AGGCTGGGTGAGCTTGGACAGGG - Intergenic
1156617096 18:38799815-38799837 TTGTTGTCTGAGGTAGTACATGG - Intergenic
1159822263 18:73160769-73160791 ATGAGTTCTGAGGATGGACATGG + Exonic
1160211290 18:76882312-76882334 GTGCTGTGGGAGGTAGGACAAGG - Intronic
1160598857 18:79997245-79997267 ATACTGTTTGAGGTTGGGTAGGG - Intronic
1161278394 19:3432143-3432165 AAGCTGTCTGAGGTTGGCCAAGG + Intronic
1162730524 19:12715759-12715781 ACGCTGCCTGAGGCTGGGCAGGG + Intronic
1162795741 19:13086705-13086727 ATGCTTTCTGGGGTGGGTCAGGG + Intronic
1164418340 19:28065132-28065154 AAGCTCTATGAGGTTGGAAAAGG - Intergenic
1165868935 19:38956998-38957020 ATGATGTCAGAGGCTGGGCATGG - Intronic
1168296758 19:55380713-55380735 ATCCTTTATGAGGTTGGGCATGG - Intronic
924968572 2:101255-101277 GTGCTGTCTGGGGCTGGAGAAGG + Intergenic
926861822 2:17317832-17317854 ATGCTGTGTGAATTTGGGCAGGG + Intergenic
928138694 2:28708856-28708878 ATGCTGTGTGATCTTGGACAAGG + Intergenic
928172619 2:29013040-29013062 AGGCTGCCTGAGGCTGGAAAAGG - Intronic
928814070 2:35268486-35268508 ATGCTTTCTAAAGTTGGACTGGG - Intergenic
928921942 2:36535553-36535575 CTGCTGTCTAAGGTTCAACAAGG - Intronic
929678046 2:43957760-43957782 AGGCTGTATGTTGTTGGACATGG + Intronic
933518528 2:83338369-83338391 ATGCTTTCTGAAATTGGACTCGG + Intergenic
937286848 2:120759274-120759296 ATGCTGTCTGCAGGTAGACAGGG - Intronic
937314541 2:120922694-120922716 GTGATGTGTGAGGTTGGCCAGGG - Intronic
937346279 2:121127786-121127808 GTGAGGTCTGAGCTTGGACATGG - Intergenic
937389701 2:121474294-121474316 ATGCTCTTTGAGGATGGAAATGG - Intronic
937755852 2:125537888-125537910 GTGCTGTGTGACCTTGGACAAGG + Intergenic
938161472 2:128988345-128988367 ATGCTGTCTGCAGTTGGAAGAGG + Intergenic
940402618 2:153265125-153265147 GTGCTGTTTGAGGTTGGGGAAGG + Intergenic
943360367 2:186911757-186911779 CTGCTGGCTGAGGAGGGACAAGG - Intergenic
943783674 2:191852340-191852362 ATGCTATCTTAGGGTGGTCAAGG + Intergenic
945919919 2:215745487-215745509 ATGCTGTGTGGGATTGGGCAGGG + Intergenic
945941389 2:215954550-215954572 CTGCTGTTTGCGGTTGGGCATGG - Intronic
947157260 2:227175054-227175076 AAGCAGACTGAGGCTGGACATGG + Intronic
1169277184 20:4241712-4241734 AGGCTGCCTGAGGTTGTGCAGGG - Intronic
1169344816 20:4821773-4821795 ATGATGGCTGAGCTTGGAGAGGG - Intronic
1169828363 20:9794570-9794592 ATGCACTGTGATGTTGGACATGG + Intronic
1170930402 20:20764743-20764765 CTTCATTCTGAGGTTGGACATGG - Intergenic
1173247932 20:41348950-41348972 ATGCTGTGTGACTTTGGGCAAGG + Intronic
1173250546 20:41362194-41362216 ATGCTGTCTGAGGTTGGACATGG - Exonic
1173620077 20:44429943-44429965 ATGAAGTCGGGGGTTGGACATGG - Exonic
1174383910 20:50175168-50175190 AAGATGTCTGCGGTTGGGCATGG - Intergenic
1177671030 21:24227707-24227729 ATGCTGTTAGAGTTTGGATAGGG + Intergenic
1178882346 21:36459611-36459633 GTGCTGTCCGAGGTGGGCCAAGG + Intergenic
1179110465 21:38441268-38441290 ATGCTAACTGAGGTTGTACTGGG + Intronic
1180138742 21:45878056-45878078 TTTCTGTCTGAGGATGGAGAGGG + Intronic
1181498472 22:23301820-23301842 CTGGTGTCTGAGGATGGACCAGG + Intronic
1182984726 22:34705719-34705741 CTCATGTCTGAGGTTGGAAAGGG - Intergenic
1183708343 22:39488510-39488532 ATACTGTCTGAAGTTGGGCATGG - Exonic
1184373210 22:44095876-44095898 ATGCTGCCTGAGGTCGCACCAGG + Intronic
1184675953 22:46043672-46043694 ATCCTCTCTGAGGTTGGTCCTGG - Intergenic
1185339950 22:50286758-50286780 CTGCTCTCTGAAGCTGGACATGG + Intronic
950643433 3:14363063-14363085 ATGCTGTGTGACGTTGGGCTTGG - Intergenic
950954023 3:17031471-17031493 ATGCTGTCTGGGATGGGATAAGG + Intronic
952422448 3:33144324-33144346 AGGCTGTCTGTGGTTGGAATGGG + Exonic
953830833 3:46296533-46296555 AAGCTGTGTGAGCTTGGGCAAGG - Intergenic
955824615 3:62932279-62932301 TGCCAGTCTGAGGTTGGACAGGG - Intergenic
957068348 3:75545291-75545313 AAGATGACTGAGGTTGGGCATGG - Intergenic
957204775 3:77182482-77182504 ATTCTGTCTGAGATGGGACAGGG + Intronic
958696103 3:97528586-97528608 ATGCTCTCTAGGGTTGGATATGG + Intronic
958930033 3:100198563-100198585 ATGCTGACTGCGGTAGGCCAGGG - Intergenic
959001825 3:100972937-100972959 TTCCTGGCTGAGGTTGAACAAGG + Intronic
960763494 3:121098550-121098572 GTGATGTCTGATGTTGGAAATGG - Intronic
961624789 3:128254465-128254487 ATGCCATCTCATGTTGGACAGGG + Intronic
962326545 3:134438706-134438728 ATGCACTGTGAGGTTGGACCTGG + Intergenic
963956327 3:151258442-151258464 ATGCTATCTGAGGCTGGCCCTGG + Intronic
966454024 3:180094427-180094449 GTGCTGTCTGGGGTTGGAAGAGG + Intergenic
966903910 3:184508138-184508160 ATGCTGTCAGAGGCTGCAGACGG + Intronic
967319071 3:188177872-188177894 TTGCTGCCCGAGGTGGGACAGGG + Intronic
969323921 4:6429963-6429985 GTGCTGTGTGACGTTGGGCAAGG - Intronic
969377163 4:6770571-6770593 ATGCTGTGTGACTTAGGACAAGG + Intergenic
970174988 4:13330580-13330602 TGCCTGTCTGAGTTTGGACATGG + Intergenic
972247703 4:37262804-37262826 ATCCTCTCTGAGGTTGCAGAGGG + Intronic
973169271 4:47119435-47119457 ATGATGTCTGAGGTTGAAGGAGG - Intronic
973291097 4:48471533-48471555 ATCATTTTTGAGGTTGGACACGG + Intergenic
973345248 4:49047843-49047865 ATGCTTACTGAGGTGGGCCAAGG + Intronic
975472621 4:74787854-74787876 AGGCTTTCTTAGGTTGGAGATGG - Intronic
975974694 4:80081469-80081491 AGGGTGTCAGAGGATGGACAGGG + Intronic
976939961 4:90687696-90687718 ATGCTGTCTGAGGTTGTGGGTGG - Intronic
983061333 4:163165121-163165143 ATGCCGTCAGAGATTGGACATGG - Intronic
984121116 4:175745800-175745822 ATGTTATCTGAGGCTGGAGAAGG + Intronic
984784863 4:183558289-183558311 TTGCTGTATGCGGCTGGACACGG + Intergenic
986055899 5:4136251-4136273 ATACTGGCTGTGGTTGGATATGG - Intergenic
990772073 5:59259279-59259301 ATGCTGGGTGATTTTGGACAAGG - Intronic
995524132 5:113037297-113037319 ATGGTGTATGAACTTGGACATGG + Intronic
996342162 5:122451089-122451111 CTGCTCTCTGAGGTGGGAGATGG - Exonic
997605361 5:135172024-135172046 ATGCTTCCTGATGTTGGACTGGG - Intronic
997611142 5:135216586-135216608 TTGCTCTCTGAGGTTCAACAAGG + Intronic
999665091 5:153904548-153904570 GTGCTGGGTGAGCTTGGACAAGG + Intergenic
1004351515 6:14894088-14894110 TTGATGTCTGATGTTGGAGATGG - Intergenic
1004408143 6:15354231-15354253 ATGCAGTTTGAGGATGGATAAGG + Intronic
1005579920 6:27224021-27224043 ATGCTGATTGAGGCTGGGCATGG + Intergenic
1006801299 6:36761330-36761352 ATGCTGAATGAGATTGAACATGG - Intronic
1007461607 6:42023135-42023157 TTCCTGGCTGAGGTGGGACAGGG + Intronic
1007753339 6:44083202-44083224 ATCCTTCCTGAGGTTGAACAGGG - Intergenic
1009996652 6:70902868-70902890 GTGGTATCAGAGGTTGGACAGGG + Intronic
1010929862 6:81788741-81788763 CTGCTCTCTGAAGTTGGAGATGG - Intergenic
1011018903 6:82788955-82788977 GTGCTGCCTGAGGTTGGAGGAGG - Intergenic
1014089906 6:117392167-117392189 ATGCTTTGTGATGTAGGACAAGG - Intronic
1017239071 6:152147264-152147286 CTTCTGTCTGAGGTTGTAAAAGG + Intronic
1017285708 6:152673616-152673638 ATGCTGTCTGAGCTTTGGAAAGG - Intergenic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1021405983 7:20267632-20267654 TTGCTGCATGAGGTGGGACATGG + Intergenic
1022501536 7:30885048-30885070 GTGTTGTGTGAGCTTGGACAAGG + Intronic
1022792162 7:33699857-33699879 ATGATGTCTGGGCTTGGAGAAGG + Intergenic
1023186828 7:37541269-37541291 AGGCTGTCTGAGGGCGGAGATGG + Intergenic
1023595077 7:41821139-41821161 ATGATTTCTGAGATTGGACAAGG + Intergenic
1024512877 7:50217027-50217049 ATGCTGCCTGTGCTTGGAAATGG - Intergenic
1024884686 7:54127177-54127199 ATGTTGCCTGAGGTAGCACAGGG + Intergenic
1026977883 7:74509633-74509655 ATGCTGTGTGACTTTGGGCAAGG - Intronic
1029700997 7:102246858-102246880 AGGCTTTCTGAGGCTGGGCATGG - Intronic
1029815649 7:103091833-103091855 CTGCTGTCTGACATTGGGCAGGG + Intronic
1033542425 7:142369253-142369275 GTGCTGCCTGAGGTTGGGGATGG + Intergenic
1034898418 7:154892362-154892384 ATGCTGTTTGAGGCTGGAGCTGG - Exonic
1035310473 7:157964671-157964693 ATGCTGCCTCAGGTTGGCCCTGG - Intronic
1035430398 7:158815726-158815748 CTGGTGTCTGAGGTTGGATGTGG - Intronic
1035584836 8:764138-764160 ATGCTGTCTGAATTGGGCCAGGG + Intergenic
1035753739 8:2014808-2014830 ATGCTGTCTGATGCTGAAAACGG + Intergenic
1036169854 8:6472756-6472778 AAACTGTCTGAGGCTGGACATGG - Intronic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1039413406 8:37374412-37374434 ATGCTGCCTGAACTTGGAGATGG - Intergenic
1039992179 8:42497793-42497815 AGACTGGCTGAGGTTGGGCACGG + Intronic
1041312412 8:56530120-56530142 ATGCTATCTGAGGGGGGAAAGGG + Intergenic
1043666465 8:82821058-82821080 GTGCTGCCTGAGGTTGGGGAAGG + Intergenic
1043983448 8:86667028-86667050 ATGTTGTCTGCGGTTTGATATGG + Exonic
1044084774 8:87930916-87930938 TTACTGTGTGAGGTTGGAAATGG - Intergenic
1045484997 8:102623948-102623970 AAGATGACTGAGGATGGACAGGG + Intergenic
1049000974 8:139825492-139825514 CTGAGGTCTGAGGTTGGGCATGG - Intronic
1049562149 8:143317244-143317266 ATGCTGTCTAAGCTTGGCGAGGG - Intronic
1049870825 8:144974380-144974402 ATGCTGTATCATGTTGCACAGGG - Intergenic
1050465352 9:5917241-5917263 ATGCTGGCTGAGGTATGACAAGG + Intronic
1051416007 9:16841315-16841337 ATGCTGTGGGAAGTTTGACAAGG - Intronic
1052041166 9:23740802-23740824 CTGCTTTCTGAGTTTGGAAAAGG - Intronic
1052842053 9:33300351-33300373 AGGCTGTAACAGGTTGGACACGG - Intronic
1053184953 9:36008200-36008222 TTGCTGTCTGAGGGTGGCAAAGG - Intergenic
1055790195 9:79915238-79915260 ATGCAATCTGAGGTTCCACATGG - Intergenic
1056004391 9:82252328-82252350 ATGCTGTCTGGGAGTGGACATGG + Intergenic
1056226707 9:84502732-84502754 ATGCTGACTGAAGTTAGCCAAGG - Intergenic
1057325922 9:94063141-94063163 ATGCTGTATCATGTGGGACAAGG + Intronic
1059290567 9:113220723-113220745 ATTCTGCCTGAGGTTGCAGAAGG + Intronic
1059344822 9:113620968-113620990 ATGCTGTGTGAGCTTGGGCAAGG - Intergenic
1061098519 9:128474110-128474132 ATGTTCTCTGAGGGTGGGCATGG + Intronic
1061385636 9:130287826-130287848 AGGGTGTCTGAGGCTGGCCATGG + Intronic
1062286529 9:135775394-135775416 CTGCTGCCTGCGGCTGGACAAGG + Exonic
1062572043 9:137190235-137190257 CTGCTGGCTGAGGAGGGACAAGG - Exonic
1186602521 X:11053204-11053226 TTGTTGTGTGAAGTTGGACAAGG + Intergenic
1187729423 X:22237942-22237964 CTGCTGACTCATGTTGGACATGG - Intronic
1188764310 X:34073587-34073609 CTGCTGTCTGAGGTATAACATGG - Intergenic
1189911957 X:45818924-45818946 ATCCAGTTTGAGGCTGGACATGG - Intergenic
1190415211 X:50174125-50174147 AAGCTGAATGAGGCTGGACATGG + Intergenic
1192244673 X:69362554-69362576 ATGCTGCCTGGGTTTGGAGATGG + Intergenic
1193264442 X:79452305-79452327 GTGCTGTCTGAGGTTGGGGGAGG - Intergenic
1194564162 X:95462332-95462354 ATTATGTCTGGGGTAGGACATGG - Intergenic
1194564617 X:95469472-95469494 ATGCTTTCTGCGCTTGAACATGG - Intergenic
1199376835 X:147122693-147122715 ATGTTTTCTTAGGTTGGAGATGG + Intergenic
1201148160 Y:11077864-11077886 ATGCAGTCTGAGGATGGGGAAGG + Intergenic
1202049180 Y:20763140-20763162 ATGCTGGCTGGGGTGTGACAGGG - Intronic