ID: 1173258823

View in Genome Browser
Species Human (GRCh38)
Location 20:41415182-41415204
Sequence ACTTCAGGCGGGAATCTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173258823_1173258828 1 Left 1173258823 20:41415182-41415204 CCACCAAGATTCCCGCCTGAAGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173258823 Original CRISPR ACTTCAGGCGGGAATCTTGG TGG (reversed) Exonic
903377451 1:22875831-22875853 AGTTCAGGAGGGCATCTCGGAGG + Intronic
903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG + Intergenic
906306896 1:44725171-44725193 CATTCAGGCGGACATCTTGGCGG + Exonic
906947362 1:50306380-50306402 AATTCAGGCAGGAACCTAGGGGG - Intergenic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
917295894 1:173518909-173518931 ACAACAGACAGGAATCTTGGGGG - Intronic
918661654 1:187095775-187095797 ACTTGAGGGGGCAATCTAGGTGG - Intergenic
922164123 1:223100786-223100808 ACTTCAGGAGGGACTCTCTGTGG - Intergenic
923768997 1:236920874-236920896 ACCTCAGCTGGGAATCCTGGAGG + Intergenic
1063196814 10:3751054-3751076 CCTGCAGCCGGGAATCCTGGCGG - Intergenic
1064865471 10:19873977-19873999 ACTTCAGGTGTGGATCTGGGTGG + Intronic
1065116586 10:22489053-22489075 CTTTCAGGCTGGATTCTTGGAGG - Intergenic
1071144871 10:82556787-82556809 ACTTCAGGGTGGAGGCTTGGAGG - Intronic
1072550303 10:96472231-96472253 ACGTCAGGCTGGACTCTTGCTGG - Intronic
1073100180 10:101002370-101002392 ACTTGAAGGGGGAGTCTTGGTGG + Exonic
1079513597 11:21240108-21240130 ACTTCAGGAGGGAATGGTAGAGG - Intronic
1086163522 11:83750153-83750175 GCTTCAGATGGGAATCTTGGGGG - Intronic
1087143632 11:94790643-94790665 ACTTCAGGGTGGAATTTTTGTGG - Intronic
1093024888 12:14236554-14236576 ACTTGAGGCGAAAATTTTGGGGG - Intergenic
1096634197 12:52948383-52948405 ACTTGTGGAGGGGATCTTGGGGG - Intronic
1096686815 12:53293399-53293421 ACTTGAGTCGGGGAGCTTGGCGG - Exonic
1098800683 12:74953578-74953600 ACTGCAGGCGCAGATCTTGGTGG - Intergenic
1107398184 13:40040720-40040742 AATTCTGCCTGGAATCTTGGAGG + Intergenic
1110844587 13:80179825-80179847 ACTTCAGGGGAGAATGGTGGAGG - Intergenic
1118215037 14:63800804-63800826 ACTTGAGGGTGGAATCTGGGAGG + Intergenic
1120053289 14:79893422-79893444 ATTTCTGGGGGGAATTTTGGGGG + Intergenic
1120328440 14:83057149-83057171 AATTCTGACGGGAATCTGGGTGG + Intergenic
1135489767 16:22899233-22899255 AATTCAGGCAGGAAACTGGGAGG + Intronic
1135971579 16:27075702-27075724 ACTGAAGGCTGGAACCTTGGTGG - Intergenic
1138032741 16:53573374-53573396 ACTTCAGGCAGCAAACTTGGGGG - Intergenic
1138244837 16:55459850-55459872 ACTGCAGGAGGGAAGCTGGGTGG - Intronic
1139293401 16:65878277-65878299 AATTCAGTCTGGAATCCTGGGGG - Intergenic
1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG + Intergenic
1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG + Exonic
1148746520 17:49921203-49921225 AATTCAGGAGGGCTTCTTGGAGG + Intergenic
1153453079 18:5251130-5251152 TCTCCAGTCGGGAATATTGGGGG + Intergenic
1160227261 18:77020680-77020702 TCTGAAGGCTGGAATCTTGGTGG - Intronic
1161636607 19:5393251-5393273 AAATCAGGCGGGCTTCTTGGAGG - Intergenic
925540543 2:4961764-4961786 ACTTCAGGAGGGTTTCTTAGAGG + Intergenic
928222086 2:29412284-29412306 AATTCAGGAAGGCATCTTGGAGG + Intronic
928712156 2:34019261-34019283 ACTGCAGGCGGGGATCATGGAGG - Intergenic
931261609 2:60624754-60624776 ACTTCACGTGTGAATCTTTGTGG + Intergenic
945333004 2:208561117-208561139 ACAGTAGGTGGGAATCTTGGGGG + Intronic
1169061588 20:2664182-2664204 ACTTCCTGCGGGAAACATGGCGG - Exonic
1170293314 20:14795368-14795390 ACTTCAGAAGTGAATCTTGAAGG + Intronic
1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173260119 20:41426843-41426865 AATTCAGGTGGGAATCTGAGGGG + Intronic
1179035672 21:37756999-37757021 ACTCCAGGCTCGAATCTTTGAGG - Intronic
1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG + Intergenic
1180963573 22:19773873-19773895 ACTGCAGGAGGGAAACTCGGCGG - Intronic
1181045972 22:20214418-20214440 CCTGCAGGCGGGAATCTGAGCGG - Intergenic
1181550933 22:23638827-23638849 ACTTTATCCGGGAATCTTGATGG - Intergenic
1184349110 22:43931912-43931934 ACTCCAGGCAAGAATCTTGATGG + Intronic
1184670099 22:46007822-46007844 ACTTCAGGCCGGAGGCTTGGCGG - Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950184617 3:10937530-10937552 ACTCCAGGCTGGGATCTGGGGGG - Intronic
954733043 3:52681585-52681607 ACATAAGGAGGGAATCTTTGTGG + Intronic
954983863 3:54771817-54771839 ACTTGGGGCAGAAATCTTGGGGG + Intronic
960171213 3:114463342-114463364 AGTTCAGGGGGAAACCTTGGAGG - Intronic
970138914 4:12958479-12958501 ACTTCAGTTGGAAATTTTGGGGG - Intergenic
971131675 4:23818001-23818023 ACTTCAGGGGGGAAAGTTGTGGG - Intronic
974896870 4:67950599-67950621 ACCGGAGGGGGGAATCTTGGGGG + Intronic
975058473 4:69966310-69966332 ACTTGAAGAGGGAATCTGGGTGG + Intergenic
996335237 5:122377087-122377109 ACTTCAAGGGTAAATCTTGGAGG - Intronic
999143929 5:149380494-149380516 ACTTGTGGCCTGAATCTTGGAGG - Intronic
1002089978 5:176798656-176798678 ACTTCAGGGTGGGATCTTGGAGG - Intergenic
1006389737 6:33751330-33751352 ACTACAGCCGGGAATGTGGGAGG + Intergenic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1013440969 6:110168557-110168579 ATTTGAAGTGGGAATCTTGGAGG - Intronic
1013908191 6:115240886-115240908 ACTTCAGGAGTGAAGCTTTGTGG + Intergenic
1020521094 7:9188416-9188438 ACTTCAGCCGGGCGTGTTGGCGG + Intergenic
1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG + Intronic
1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG + Intergenic
1040077188 8:43247516-43247538 ACCTGGGGCGGGGATCTTGGAGG + Intergenic
1040530067 8:48259989-48260011 ACCTCAGGAGAGGATCTTGGAGG + Intergenic
1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG + Intergenic
1193044994 X:77043534-77043556 ACTTGAGGCTGGAATGTGGGGGG + Intergenic
1195665676 X:107428053-107428075 ACATGAGTCAGGAATCTTGGGGG + Intergenic