ID: 1173258823

View in Genome Browser
Species Human (GRCh38)
Location 20:41415182-41415204
Sequence ACTTCAGGCGGGAATCTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173258823_1173258828 1 Left 1173258823 20:41415182-41415204 CCACCAAGATTCCCGCCTGAAGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173258823 Original CRISPR ACTTCAGGCGGGAATCTTGG TGG (reversed) Exonic