ID: 1173258828

View in Genome Browser
Species Human (GRCh38)
Location 20:41415206-41415228
Sequence TCTGCTCCTTCAAAAAGATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173258821_1173258828 10 Left 1173258821 20:41415173-41415195 CCTCAATACCCACCAAGATTCCC 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232
1173258824_1173258828 -2 Left 1173258824 20:41415185-41415207 CCAAGATTCCCGCCTGAAGTGTC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232
1173258823_1173258828 1 Left 1173258823 20:41415182-41415204 CCACCAAGATTCCCGCCTGAAGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232
1173258822_1173258828 2 Left 1173258822 20:41415181-41415203 CCCACCAAGATTCCCGCCTGAAG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232
1173258825_1173258828 -10 Left 1173258825 20:41415193-41415215 CCCGCCTGAAGTGTCTGCTCCTT 0: 1
1: 0
2: 0
3: 21
4: 304
Right 1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173258828 Original CRISPR TCTGCTCCTTCAAAAAGATG AGG Exonic
905022109 1:34825262-34825284 TCTGCTGCCTCCAAAAGCTGTGG + Intronic
905274158 1:36806294-36806316 TCTCCACCTTCGAGAAGATGTGG - Exonic
905656648 1:39690282-39690304 TCTGATCCTTCATGAAAATGGGG - Intronic
905820387 1:40985556-40985578 TTTGCTGCTTTAAAAAGGTGGGG + Intronic
906696947 1:47829484-47829506 TCTGCTCCTGCAGACGGATGTGG - Intronic
909402123 1:75245362-75245384 TCTTAACCTTCTAAAAGATGTGG - Intronic
910654425 1:89605478-89605500 CCTGCTACTTCTAAGAGATGTGG - Intergenic
912865244 1:113250595-113250617 TCTGCTACTTTAAAAAGGAGGGG + Intergenic
912878638 1:113388124-113388146 TTTTCTCCTTCATAAAAATGGGG + Intergenic
913149955 1:116031754-116031776 TCTGCTACTTGAGAAAGACGGGG - Intronic
914738472 1:150441992-150442014 TCTTCTGCTCCAAAAAGAGGAGG - Intronic
916341220 1:163737875-163737897 TCTAATCCATCAAAAAGAAGGGG - Intergenic
918042108 1:180919712-180919734 TCTCCTCCTTGAAAATGAGGGGG - Intronic
919426244 1:197435073-197435095 TATTATCCTTCAAAAAGTTGAGG - Exonic
919838421 1:201592411-201592433 TCTGTTTCTTCAACAAAATGAGG - Intergenic
923561058 1:235042299-235042321 TCTGAGCCTTCAACAAGATGAGG + Intergenic
1062990827 10:1814623-1814645 TCTTCTCCTTCAAAAAGGTTTGG - Intergenic
1063188758 10:3673629-3673651 TAAGCTCTTTCAAAAAGTTGTGG + Intergenic
1064890633 10:20168119-20168141 TTTGCTCCCTCAAAAAGAGAGGG + Intronic
1065541900 10:26778839-26778861 TCTGCCCATTATAAAAGATGTGG + Intronic
1066583435 10:36905766-36905788 CATCCTTCTTCAAAAAGATGAGG + Intergenic
1066988276 10:42487574-42487596 TCTTTTTCTTCAAAATGATGAGG - Intergenic
1067808697 10:49410495-49410517 TCTGCTACTTAATAAAGATAAGG - Intergenic
1068029746 10:51691955-51691977 TCTGATGCTTAAAATAGATGAGG + Intronic
1069294398 10:66826064-66826086 TTTGCTCCTTCAAAAGGAAGGGG + Intronic
1069531774 10:69225079-69225101 GCTGCTCTTTCAATAAGTTGAGG - Intronic
1071364304 10:84883228-84883250 CCAGCTCCTTCAAGATGATGGGG + Intergenic
1071891963 10:90019074-90019096 TCTGCGGCTTCAAAGAGATTTGG - Intergenic
1074662459 10:115677233-115677255 GCTGCTCCATGAAAAAGATATGG + Intronic
1075206684 10:120455253-120455275 TCTCTGCCTTCAAGAAGATGGGG - Intergenic
1082266768 11:50127612-50127634 AGTGCTCCTTCTAAAAGAAGGGG + Intergenic
1082289321 11:50350956-50350978 AGTGCTCCTTCTAAAAGAAGGGG - Intergenic
1082792124 11:57353354-57353376 TCTTCTCCTTTATAAAGTTGGGG - Intronic
1082835048 11:57645615-57645637 TCTGTTCACTCAAAAAGAGGTGG + Exonic
1083004138 11:59325470-59325492 TCTTTTCCTTCAAAAAGAAAAGG + Intergenic
1085032025 11:73277691-73277713 GCTGCCCCTTATAAAAGATGCGG - Intronic
1087192351 11:95268232-95268254 TCTGGTCATTTAAAAATATGTGG + Intergenic
1087276967 11:96170574-96170596 TCTATTCCTTCACAAAGAAGGGG + Intronic
1091193187 11:133711285-133711307 TGTGCTCCATGAAAAAGAGGAGG + Intergenic
1092191195 12:6522276-6522298 TCTGCTCCTTTAAAAGGCAGGGG + Intronic
1093061995 12:14617048-14617070 TCTGGTCATTTAAAAAGGTGTGG + Intronic
1094435238 12:30413824-30413846 TCTTCTTCCCCAAAAAGATGTGG + Intergenic
1094677877 12:32638805-32638827 TCTGTCCCTTCAGACAGATGTGG - Intronic
1095627736 12:44337277-44337299 TCTGCTCCTTCTACTACATGAGG - Intronic
1095865068 12:46962754-46962776 TCTGATCTCTCAAAAAGATGAGG + Intergenic
1097267730 12:57755546-57755568 TCAGCTCGTTCAGAAACATGCGG - Exonic
1098654724 12:73013594-73013616 TCTGCTCCTGCAAAGAGATCCGG + Intergenic
1101757193 12:107630133-107630155 TCTGTTCCTTGAAAAAGAAGCGG + Intronic
1104179793 12:126368183-126368205 TCTGCTTCTCCATAAGGATGGGG - Intergenic
1106023576 13:25936934-25936956 TCTGCTGCTTCAATAAGCGGAGG - Intronic
1107516758 13:41136791-41136813 TCTGATCGTTTAAAAATATGTGG + Intergenic
1107945867 13:45417484-45417506 TCTGCACCTTTAAAAAGAATAGG - Intronic
1109085387 13:57965054-57965076 TCTCCTGCTTCAAAAAGCTATGG - Intergenic
1109771628 13:66982085-66982107 TCTGCTCCTTTAAAGGCATGTGG + Intronic
1109887327 13:68558999-68559021 TCTACTCCTGCAAACAGATGAGG + Intergenic
1111291618 13:86178458-86178480 TCTGGTCCTTTAAAAGTATGTGG - Intergenic
1111386364 13:87533852-87533874 TCTGCTCCTTCAAATAATTCTGG + Intergenic
1111685509 13:91496547-91496569 TTTGCTCCTACAAATAAATGAGG - Intronic
1112249760 13:97769050-97769072 ACAGCTGCTTCAGAAAGATGGGG + Intergenic
1113330647 13:109323815-109323837 TCAGCTGCTTCAAGATGATGAGG - Intergenic
1113507558 13:110827566-110827588 TCTGGTCATTTAAAAATATGTGG + Intergenic
1113615531 13:111677890-111677912 GCTGCTGGTTCACAAAGATGGGG + Intergenic
1113620999 13:111762792-111762814 GCTGCTGGTTCACAAAGATGGGG + Intergenic
1115364692 14:32544628-32544650 TTTTCTCCTTCAAAAGGGTGGGG + Intronic
1116352844 14:43887433-43887455 TCTGGTCCTTTAAAAGGATGTGG + Intergenic
1116354603 14:43913172-43913194 TCTGCTCCTTCAAAAATGTTTGG + Intergenic
1120594515 14:86417163-86417185 TCTGCTGCTTCAGGATGATGGGG + Intergenic
1121669358 14:95696025-95696047 TCTGCTCCTTAAAATACATGTGG - Intergenic
1121847432 14:97185417-97185439 TCTGCTGTTTCTAGAAGATGGGG + Intergenic
1124845281 15:33283891-33283913 TCTTCTCCTCCAATCAGATGTGG + Intergenic
1125036424 15:35129750-35129772 TCTGCTCTTTTAAAAAATTGGGG + Intergenic
1126692305 15:51297184-51297206 TCTGCTCCATCAGAATAATGTGG - Intronic
1126829744 15:52589243-52589265 TCTGCTCATTTAAAAAAAAGTGG - Intronic
1127569675 15:60229791-60229813 TCTTCTACTTCGCAAAGATGTGG - Intergenic
1127902312 15:63349932-63349954 TCTTCTCCTCAAAAAAGAGGAGG + Intronic
1128297735 15:66539024-66539046 ACTGCTACTTCAATAAGCTGGGG - Intronic
1128839229 15:70836289-70836311 TCACATCCTTCAAAAAGGTGAGG - Exonic
1130506437 15:84547664-84547686 TTTGATCCTTCAAACAGAAGTGG - Intergenic
1131533246 15:93212713-93212735 TCTGCGCCTCCCAAAAGCTGGGG - Intergenic
1131553464 15:93377319-93377341 TCAGGTCCTTCAAAAGGATCTGG - Intergenic
1132339513 15:101069133-101069155 CCTGCTCCTGCAAACTGATGGGG - Exonic
1132740800 16:1412018-1412040 TCAGCTCCTTCCAAAAGATCAGG + Intronic
1133592998 16:7264201-7264223 TGTGTTCCTTCAAAAAGACAAGG + Intronic
1135002438 16:18788245-18788267 ACTGCTTCTCCAAAAAGTTGGGG + Intronic
1135269138 16:21053857-21053879 GCTCCTCCTTTAAAAAGAAGAGG - Intronic
1138353795 16:56362050-56362072 TTTGGTCCTTGAACAAGATGTGG - Exonic
1139806321 16:69567069-69567091 CCTTCTCCTTTACAAAGATGGGG + Intronic
1140559860 16:75966520-75966542 TCTCCTCCATCAAAGCGATGAGG - Intergenic
1142033700 16:87851201-87851223 TCTGCTTTTTAAAGAAGATGAGG - Intronic
1144039754 17:11399726-11399748 TCTGCTACTCTAAAAAAATGGGG - Intronic
1144483495 17:15646286-15646308 CCTGTTCCTTGAAAATGATGGGG + Intronic
1144915192 17:18718741-18718763 CCTGTTCCTTGAAAATGATGGGG - Intronic
1149210330 17:54293233-54293255 TTTCCTCCTTAAAAAAGATAAGG + Intergenic
1151277411 17:73046038-73046060 TCTTCTCCTTCAAACATAGGAGG - Intronic
1153237414 18:3001197-3001219 TGTGCTCCATCAAAATGAGGAGG + Intronic
1154490980 18:14922106-14922128 TCTCCTCCTGCCAGAAGATGAGG - Intergenic
1156988028 18:43372369-43372391 TCTAGTCCTTCAAGATGATGAGG + Intergenic
1157543841 18:48533902-48533924 TCTGGTCATTCAAAAGTATGTGG - Intergenic
1158333649 18:56390864-56390886 TGTGCTCCGTAATAAAGATGTGG + Intergenic
1159916705 18:74194443-74194465 TCTCTTCTTTCAAAAAGATTTGG + Intergenic
1161853028 19:6747933-6747955 TCTTCTTCTTCTAAGAGATGGGG - Intronic
1163264231 19:16208646-16208668 CCTGCTCCTTCAGCAGGATGGGG + Intronic
1167863713 19:52306921-52306943 TCTTTTTCTTCAAAATGATGAGG + Intronic
926063610 2:9820321-9820343 CCTGCTCCTTCAGGAAGCTGGGG + Intergenic
926229357 2:10990951-10990973 TCTTCTCCTCCCAAAAGAAGAGG + Intergenic
927636359 2:24820033-24820055 CCTTCCCCTTCACAAAGATGGGG + Exonic
927929289 2:27033845-27033867 TGGGCTCTTTCATAAAGATGGGG - Intronic
928603476 2:32923447-32923469 TCTCCTCATTGAACAAGATGTGG - Intergenic
929073159 2:38054885-38054907 TCTGCTCTCTCAAAAGGACGGGG + Intronic
929321535 2:40549216-40549238 TCTTCACCTTTAAAATGATGGGG + Intronic
930609441 2:53524815-53524837 TCTGCTTCTCTGAAAAGATGAGG + Intergenic
931251316 2:60532858-60532880 TTAGCTCCTTCAAAATCATGTGG - Intronic
932791176 2:74655296-74655318 TATGATCCTTTGAAAAGATGTGG + Intronic
933728944 2:85442782-85442804 TCTTCTCTTTTTAAAAGATGGGG - Intergenic
935106943 2:100053656-100053678 TCTGCTGATTCAAGAAGAGGAGG + Intronic
935978055 2:108598737-108598759 CCTGGTCTTTCAAAAAGCTGTGG + Intronic
936135673 2:109891331-109891353 CCTGGTCTTTCAAAAAGCTGTGG + Intergenic
936209024 2:110480154-110480176 CCTGGTCTTTCAAAAAGCTGTGG - Intergenic
939418435 2:141932093-141932115 TTTGCTCATTCAAAGAAATGAGG - Intronic
939720447 2:145643982-145644004 TCTTCGCATTCTAAAAGATGTGG - Intergenic
941256938 2:163243763-163243785 TCTGTTCATTTAAAAATATGTGG - Intergenic
943546906 2:189292367-189292389 TCTGCTGCTTCCAAAAGTTGAGG + Intergenic
943604366 2:189959337-189959359 ACTGCTATTTCAGAAAGATGTGG + Intronic
944448774 2:199819580-199819602 GCTGCCCCTTCCCAAAGATGTGG - Exonic
944476222 2:200109620-200109642 TCTCATCACTCAAAAAGATGTGG + Intergenic
945129193 2:206549299-206549321 TTAGCTCATTCATAAAGATGTGG + Intronic
947125829 2:226867547-226867569 TCTCCTACTTAAAAAAAATGAGG - Intronic
947521716 2:230850551-230850573 TCTGCTCTTCTAAAAAGCTGTGG - Intergenic
1169297473 20:4412554-4412576 TCTGCTACTTTAAAAAGCTGAGG + Intergenic
1169541319 20:6603052-6603074 TCCGCTCTTTTACAAAGATGAGG - Intergenic
1170440516 20:16374723-16374745 ACTGCTGCTTCAAAAAGAGTTGG + Intronic
1173258828 20:41415206-41415228 TCTGCTCCTTCAAAAAGATGAGG + Exonic
1173943865 20:46934537-46934559 TCAGCTCCATCCAAAGGATGTGG + Intronic
1175050853 20:56154128-56154150 TCTGCTGCTGCAAAATTATGGGG + Intergenic
1175417727 20:58812640-58812662 GCTGTTCCTTCAGAAAGCTGAGG + Intergenic
1177268601 21:18815930-18815952 CCTACTCCTTCATAAAGAAGTGG + Intergenic
1177437253 21:21071688-21071710 TCTGGTTTTTCAAAAAGTTGTGG + Intronic
1178029414 21:28506944-28506966 TCTGGTCATTTAAAAATATGTGG - Intergenic
1179303236 21:40131674-40131696 TCTGCATTTTCAAAAAGAAGTGG - Intronic
1179442696 21:41406449-41406471 TCTGCTCCTTCAACAGGAACAGG - Intronic
1182354884 22:29718450-29718472 TCTGCTCCATCAAAAACACTGGG + Intergenic
1182986100 22:34718535-34718557 TTTGCTCATTCAGTAAGATGTGG - Intergenic
951670741 3:25179039-25179061 TCTGATCATTAAAAAAGAAGGGG - Intronic
953746943 3:45582248-45582270 TCTACTCCTTTACACAGATGAGG - Intronic
958946433 3:100367523-100367545 TCTCCACCTTTATAAAGATGGGG + Intronic
959247234 3:103887671-103887693 TTTCTTCCTTCAGAAAGATGAGG + Intergenic
960694898 3:120386546-120386568 TCTGATCATTCAAAAAAATTGGG - Intergenic
960795355 3:121480623-121480645 TCTGCACTTTCAAAAATGTGTGG - Intronic
960830904 3:121846790-121846812 TCTTCTCCTCCAAAGAAATGAGG + Intronic
964245292 3:154644813-154644835 TTTTCTCTTTCAAACAGATGTGG + Intergenic
964436398 3:156658451-156658473 TCTGCTGCAGCAACAAGATGGGG - Intergenic
964766270 3:160181106-160181128 TCTGCTCCTTCCAAAAACTCTGG + Intergenic
966709530 3:182956524-182956546 TCTTCTCCATCATATAGATGAGG - Intronic
967380278 3:188849972-188849994 TCTGTTCATTTTAAAAGATGAGG + Intronic
967381043 3:188858346-188858368 TCTGATCCTTGAAAAATGTGGGG - Intronic
970016701 4:11520037-11520059 TCTGCTCATACCAAAAGATAAGG + Intergenic
970190188 4:13508645-13508667 TCTGGTCATTTAAAAAGGTGTGG + Intergenic
971000314 4:22315354-22315376 TCTGCTCCTTCTAGACAATGCGG + Intergenic
971144106 4:23957863-23957885 TCTGGTCTTTAAAAAACATGAGG + Intergenic
972977247 4:44651524-44651546 TCTGATCCTTCTAAAAGACTTGG - Intronic
973850270 4:54954985-54955007 TCTGTTCCTTTGGAAAGATGGGG + Intergenic
975069120 4:70111187-70111209 TATTTTCCTTCATAAAGATGTGG + Intergenic
976280657 4:83323843-83323865 TCCCTTCCCTCAAAAAGATGAGG + Intronic
979150387 4:117306730-117306752 TCTGATCCTTCACAAACATTGGG - Intergenic
981328408 4:143478727-143478749 ACTGCTCTTTGAAAAAGTTGAGG - Intergenic
981333179 4:143536561-143536583 TCTGCTCCATCAAAGAGATATGG - Exonic
982821695 4:159948404-159948426 CCTGCTCCATCAAAAACAGGTGG - Intergenic
983187557 4:164717635-164717657 CCTGCTACTCCAAAAAGAAGTGG - Intergenic
983853729 4:172616116-172616138 TCTGTCCCTTCATAAAGATCTGG + Intronic
984133490 4:175907373-175907395 TCTGCTACTTCAAACAGATGCGG - Intronic
984192959 4:176626082-176626104 TCTGCTCCTTACAATACATGTGG - Intergenic
984727681 4:183036992-183037014 TCTACTTCTTCATAAAGAAGAGG - Intergenic
984815561 4:183832837-183832859 TCGGCTCAATTAAAAAGATGAGG + Intergenic
986702186 5:10421456-10421478 ACTGTTCCTTCAAAAACTTGGGG - Intronic
987146694 5:14998083-14998105 TCTTCTCCCTCAAAGAGAAGAGG + Intergenic
988651176 5:33153164-33153186 TCTTCTCCTTTAAGAAGAGGTGG + Intergenic
990248853 5:53892296-53892318 TTAGCTCCTTCAAACTGATGGGG + Intronic
991244333 5:64492996-64493018 TTTGCTCATTTAAAAAGTTGTGG - Intergenic
991332019 5:65502216-65502238 TTTGCTCTATCAAAAGGATGAGG - Intergenic
992176634 5:74155955-74155977 ACTGCTTATTCAAAATGATGAGG - Intergenic
993513492 5:88800568-88800590 TCTGTTCCTGGAAGAAGATGTGG - Intronic
994699975 5:103121011-103121033 TCTGCGCCTTGAAGAAGAAGGGG + Intronic
996073798 5:119164764-119164786 TTTGCTGCTTCAAAAACAAGAGG - Intronic
997836457 5:137197273-137197295 TTTGCACCATTAAAAAGATGTGG + Intronic
997841055 5:137240413-137240435 TCTGGTCATTTAAAAATATGTGG - Intronic
1000284576 5:159816033-159816055 TCTGTTCCATTAAAAACATGAGG + Intergenic
1000373349 5:160557824-160557846 TCTCCTCCTTTAAAATGAGGAGG - Intergenic
1000696848 5:164396865-164396887 TCTGCTCATTTTTAAAGATGGGG - Intergenic
1002165901 5:177345604-177345626 TCTGCTCCTTCAGGAAGACAGGG + Intronic
1002326785 5:178415029-178415051 TCTGCTTCCACAATAAGATGAGG + Intronic
1003626208 6:7743943-7743965 TTTGCTTCCTCAAAAAGGTGTGG - Intronic
1005403639 6:25462002-25462024 TTTGCTCATTTAAAAAAATGGGG + Intronic
1005918481 6:30376238-30376260 TCCTCTCCTTTAAAAATATGGGG - Intergenic
1006299078 6:33184318-33184340 TCTGCTCCTTCCCAGGGATGGGG + Intronic
1008763297 6:54880129-54880151 TCTGCTAATTCATACAGATGGGG + Intronic
1009293209 6:61910064-61910086 TCAGCTCCTACAAACAGATTAGG + Intronic
1009686862 6:66971057-66971079 TTTGCTCTTGCAGAAAGATGTGG + Intergenic
1010164353 6:72897885-72897907 TGTGCTTCTTCTAAAAAATGAGG + Intronic
1011412415 6:87079589-87079611 TCTCCATCTTCACAAAGATGTGG + Intergenic
1013079347 6:106799072-106799094 TCTGCTCCTTCAAAGGAGTGAGG + Intergenic
1013650961 6:112193978-112194000 TCTGGTCTATGAAAAAGATGGGG + Intronic
1014558625 6:122863623-122863645 ACTGCACATTCAAAAAGATCTGG - Intergenic
1015411758 6:132901406-132901428 TTTCCTTCTTCAAAAAGATGAGG - Intergenic
1016225368 6:141728835-141728857 ACTGCTCCTTTAAAAAAATCAGG + Intergenic
1016392716 6:143591439-143591461 TCTGCTCCTGTAACAAGCTGTGG - Intronic
1016519896 6:144935375-144935397 ACTTCTCCTTCAAAACAATGGGG + Intergenic
1016826558 6:148393648-148393670 CCTTCTCATTCAAACAGATGGGG + Intronic
1017125185 6:151058394-151058416 TCTGATCTTTCAGAAAGCTGTGG + Intronic
1017772708 6:157655316-157655338 TCTCCTACTTAAAAAAGGTGGGG - Intronic
1021536128 7:21706843-21706865 TTTGCTCCTTTGAAAAGCTGTGG - Intronic
1023792574 7:43764857-43764879 TCTGCACCTTGAAATAGAAGAGG - Intronic
1027444061 7:78252210-78252232 TCTGCTTTTTCAAAATAATGTGG - Intronic
1027691738 7:81354887-81354909 GCAGCTCCTTCAAAACGTTGTGG + Intergenic
1028925066 7:96348755-96348777 TCTGATCCTTTAAAAATGTGTGG + Intergenic
1031818155 7:126466404-126466426 TCTACTTCTTCAAAAGGAAGAGG - Intronic
1032602327 7:133310989-133311011 TCTTCTACTTCAAAAACATCTGG - Intronic
1033300390 7:140179447-140179469 TCTGGTCATTGAAAAATATGTGG + Intergenic
1033509836 7:142048904-142048926 TCTGTTCCTTAAAATAGCTGTGG - Intronic
1039591213 8:38750975-38750997 TCTCCTCTTTCAAAACGATGTGG - Intronic
1040880494 8:52199631-52199653 TCTGTTGCTTTTAAAAGATGGGG + Intronic
1041158550 8:55012892-55012914 TCTGCTTGGTCAAAAAGAAGAGG - Intergenic
1041457830 8:58079261-58079283 TCTGCTTTTTTAAAAAGAGGAGG + Intronic
1042828665 8:73003865-73003887 TATGCTGCTTCAAAAAGTAGAGG + Intergenic
1043164009 8:76880503-76880525 TCAGTTGCTTCAAAATGATGGGG + Intergenic
1045981301 8:108191549-108191571 GCTGTTGCTTGAAAAAGATGTGG - Intergenic
1046961068 8:120113422-120113444 TCTGCTCATTCAAAATAATTTGG + Intronic
1047026360 8:120828881-120828903 GCTGCTCCTCCATAAAGAGGTGG + Intergenic
1047191682 8:122683912-122683934 TCTGCTCCTTAATAAAAGTGGGG - Intergenic
1049149349 8:141024335-141024357 CCTGCTCCTTCTGAAAGATTCGG - Intergenic
1049568378 8:143355557-143355579 TCTAATCTTTGAAAAAGATGTGG + Intronic
1049994605 9:1023142-1023164 TTTGCTCCTTCCAAACTATGTGG + Intergenic
1051139997 9:13968390-13968412 TTTGCTCCTTGCAAAAAATGAGG - Intergenic
1052291734 9:26849369-26849391 TGTGCTCCTTCACTAAGATGGGG - Intronic
1052709245 9:32032984-32033006 TCTGCTCCTTTAAAAGTGTGTGG - Intergenic
1052914398 9:33913263-33913285 TCTGTTTCTTTAAAAAGAGGTGG - Intronic
1053118585 9:35527801-35527823 TCTGCTTCTACCAAAAGCTGTGG + Intronic
1054732295 9:68713585-68713607 CCTGCTCCTTCAGAAATATGAGG + Intronic
1056553642 9:87671887-87671909 TTTGCTTCTACATAAAGATGAGG - Intronic
1059310709 9:113387314-113387336 TCTGATCCTTCAAAGAGGTCAGG + Exonic
1060685086 9:125602899-125602921 TCTCCTTCTTTTAAAAGATGGGG + Intronic
1185830097 X:3293277-3293299 TGTGCTCCTGCAAGAAGAGGAGG + Intergenic
1189686118 X:43565135-43565157 TCTACTTCTTCATAAAAATGTGG - Intergenic
1192433260 X:71126582-71126604 TCTGCCCCTTCAAATAGCTTGGG - Intronic
1197565440 X:128078713-128078735 TCTGCTCCTTACATAAGATAAGG + Intergenic
1198530470 X:137546741-137546763 ACTGCTTCTTCAAAAAGTGGGGG - Intergenic
1199329421 X:146542047-146542069 TCTGATTCTTCAAGAATATGTGG - Intergenic
1199557844 X:149128274-149128296 TCTGCTCATTTAAAAGTATGTGG + Intergenic
1200635307 Y:5645215-5645237 TCTGATCCCTGAAAAAGATTTGG - Intronic
1200751618 Y:6950652-6950674 TCTCATCCTTTAAAAAGCTGTGG + Intronic
1200852903 Y:7904048-7904070 TCCTCTGCTTCAAAAAGCTGGGG + Intergenic
1201247876 Y:12024232-12024254 TGTGCTCCTGCAAGAAGAGGAGG - Intergenic
1201363111 Y:13174992-13175014 TCTGTTTCTTCAAAATAATGAGG + Intergenic