ID: 1173260119

View in Genome Browser
Species Human (GRCh38)
Location 20:41426843-41426865
Sequence AATTCAGGTGGGAATCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 762}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173260112_1173260119 21 Left 1173260112 20:41426799-41426821 CCTTCTTGGTCTCAGGAATGGAA 0: 1
1: 0
2: 3
3: 26
4: 190
Right 1173260119 20:41426843-41426865 AATTCAGGTGGGAATCTGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173260119 Original CRISPR AATTCAGGTGGGAATCTGAG GGG Intronic
901614687 1:10529101-10529123 AATTCAGGTGGGGATGCGTGGGG + Intronic
901840733 1:11952481-11952503 AATTCAGGAGGACTTCTGAGAGG + Intronic
902705326 1:18200305-18200327 AATTCAGGTAGGAAGCAAAGGGG - Intronic
904995925 1:34631235-34631257 AAATCAGGTGGGTATTTTAGCGG - Intergenic
905244880 1:36605862-36605884 AGTACAGGTGGGAATGTGTGTGG + Intergenic
905497693 1:38406738-38406760 AATTCAGCTGTGAATCTGTCTGG - Intergenic
905807575 1:40888017-40888039 AATTCAGGTAGGAAACAGTGGGG - Intergenic
905946108 1:41902495-41902517 AATTAGGGTGGGAATATGAAAGG - Intronic
906014340 1:42560993-42561015 AATTCAGCTGTGAATCTGTCTGG - Intronic
908451049 1:64255305-64255327 AATTCAGCTGTGAATCTGTCTGG - Intronic
908660404 1:66428834-66428856 AATTCAGCTGTGAATCTGCCTGG + Intergenic
908667902 1:66512429-66512451 AATTCAGCTGAGAATCTGTCTGG - Intergenic
908864686 1:68533763-68533785 AATTCAGCTGTGAATCTGTCTGG - Intergenic
909165182 1:72213753-72213775 AATTCAGCTGTGAATCTGTCTGG - Intronic
909242027 1:73225509-73225531 AATTTAGGTAGGAATGTGATTGG - Intergenic
909322630 1:74309039-74309061 AATTCAGCTGTGAATCTGTCTGG - Intronic
909431752 1:75596336-75596358 AATTCAGCTGTGAATCTGTCTGG - Intronic
909689567 1:78391894-78391916 AATTCAGATGTGAATCTGTCTGG + Intronic
910612272 1:89157745-89157767 AATTCAGCTGTGAATCTGTCTGG - Intronic
910701017 1:90074203-90074225 CATGCAGGAGGGAACCTGAGGGG - Intergenic
910940949 1:92533324-92533346 AATTCAGCTGTGAATCTGTCTGG - Intronic
911058321 1:93726441-93726463 AATTCTGTTGGGATTGTGAGGGG + Intronic
911374916 1:97040534-97040556 AATTCAGCTGTGAATCTGCCTGG + Intergenic
911690135 1:100823596-100823618 AATTCAGCTGTGAATCTGCCTGG - Intergenic
911700498 1:100946890-100946912 AATTCAGCTGTGAATCTGTCTGG + Intronic
911954739 1:104219668-104219690 AATTCAGCTGTGAATCTGTCTGG + Intergenic
911998643 1:104800515-104800537 AATTCATGTGTTAATCTGATTGG - Intergenic
913362833 1:118001424-118001446 AATTCAGCTGTGAATCTGTCTGG + Intronic
914441116 1:147707610-147707632 AATTCAGCTGTGAATCTGTCAGG + Intergenic
916140885 1:161696692-161696714 AATTCAGCTGTGAATCTGTCTGG - Intergenic
916182863 1:162102547-162102569 AATTCAGGTGTGAATCCATGTGG + Intronic
916704571 1:167335637-167335659 AGTTGAGGTGGTCATCTGAGAGG + Intronic
916872876 1:168936429-168936451 AATTCAGCTGTGAATCTGTCTGG + Intergenic
916916415 1:169411425-169411447 AATTCAGCTGTGAATCTGTCTGG - Intronic
917338215 1:173947353-173947375 ATTTCAGGTAAGAATCTCAGAGG - Exonic
917769089 1:178257231-178257253 AAGTCAGCTGGGATTCTGACAGG - Intronic
917810734 1:178655920-178655942 AATTCAAGGGGCAATCTGGGTGG + Intergenic
917914387 1:179686646-179686668 AATTCGGCTGTGAATCTGACTGG + Intronic
917998218 1:180463593-180463615 AATTCAGCTGTGAATCTGTCTGG - Intronic
918169130 1:181978822-181978844 AATTCAGCTGTGAATCTGTCTGG - Intergenic
918589367 1:186223416-186223438 AATTCAGCTGTGAATCTGTCTGG - Intergenic
918592831 1:186259201-186259223 AATTCAGCTGTGAATCTGTCTGG + Intergenic
919089394 1:192960275-192960297 AATCCAGGTGGGAAAGGGAGGGG + Intergenic
919128842 1:193429097-193429119 AATTCAGCTGTGAATCTGTCTGG + Intergenic
919214215 1:194531472-194531494 AATTCAGCTGTGAATCTGTCTGG + Intergenic
920893604 1:210019711-210019733 AATTGAGGTTGAAATTTGAGTGG - Intronic
920992844 1:210956506-210956528 AATTCAGCTGTGAATCTGTCTGG + Intronic
921793831 1:219319929-219319951 TATTCAGGTGGGACTGTGACTGG - Intergenic
922143852 1:222918293-222918315 AATACCAGTGGGAATCTTAGTGG - Intronic
922399303 1:225235643-225235665 AATTCAGCTGTGAATCTGCCTGG + Intronic
922469372 1:225866514-225866536 GACTCAGGTGGGAGTCGGAGTGG - Intronic
923434121 1:233952553-233952575 AACACAGGTGGGAGTCTGTGTGG - Intronic
924195493 1:241602817-241602839 ATTCCACGTAGGAATCTGAGAGG + Intronic
924285761 1:242484596-242484618 AATTCAGCTGTGAATCTGTCTGG - Intronic
924613839 1:245595765-245595787 AATTCAGCTGTGAATCTGTCTGG + Intronic
924831017 1:247595005-247595027 AATTCAGCTGTGAATCTGTCTGG + Intergenic
924885118 1:248206914-248206936 AATTCAGCTGTGAATCTGTCTGG + Intergenic
924894464 1:248320767-248320789 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1063081081 10:2767690-2767712 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1063941038 10:11129482-11129504 AATTCAGCTGTGAATCTGTCTGG + Intronic
1064556934 10:16556342-16556364 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1064823450 10:19366382-19366404 AGCTCAGGTGGTAATGTGAGTGG + Intronic
1064865471 10:19873977-19873999 ACTTCAGGTGTGGATCTGGGTGG + Intronic
1064867934 10:19903279-19903301 AATTCAGCTGTGAATCTGTGTGG + Intronic
1065269856 10:24017454-24017476 AATTAAGGTTGGCATCTGTGTGG - Intronic
1065894309 10:30148949-30148971 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1066297872 10:34071017-34071039 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1066473099 10:35718420-35718442 AATTCAGGTTGAGATTTGAGTGG + Intergenic
1066522848 10:36242085-36242107 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1066583819 10:36910066-36910088 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1066595078 10:37041357-37041379 AATTCAGCTGTGAATCCGTGTGG + Intergenic
1066595668 10:37047132-37047154 AATTCAGCTGTGAATCCGTGTGG + Intergenic
1067924244 10:50491705-50491727 AATTCAGCTGTGAATCTGTCTGG - Intronic
1069218161 10:65848857-65848879 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1069805586 10:71121836-71121858 AATTCAGCTGTGAATCTGAGTGG + Intergenic
1070054288 10:72920051-72920073 AATTCAGCTGTGAATCTGTCTGG + Intronic
1070465183 10:76714840-76714862 AATTCAGCTGTGAATCTGACTGG - Intergenic
1070560900 10:77565865-77565887 CATTCATGTGGGGATCTCAGGGG - Intronic
1071015558 10:80993316-80993338 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1071060664 10:81568371-81568393 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1071922598 10:90368404-90368426 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1073538186 10:104296649-104296671 AACACAGGTTGGAATTTGAGGGG + Intronic
1073701223 10:105929063-105929085 AATTCAGTTGTGAATCTGTCTGG - Intergenic
1073962686 10:108952065-108952087 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1074241160 10:111640635-111640657 AATTCAGCTGTGAATCCGTGTGG - Intergenic
1074361248 10:112825418-112825440 ATTTCATGTGGGACTCTGCGGGG + Intergenic
1074480182 10:113812623-113812645 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1075720542 10:124584050-124584072 AAGTCAGCTGGGATTCTGAAGGG + Intronic
1075983582 10:126763629-126763651 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1077201895 11:1311997-1312019 AATTCTGCCAGGAATCTGAGGGG + Intergenic
1078034109 11:7784676-7784698 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1078091849 11:8268808-8268830 AATTAACAGGGGAATCTGAGGGG - Intergenic
1078813755 11:14798535-14798557 AATTCAGCTGTGAATCTGTCTGG + Intronic
1078994347 11:16681999-16682021 AATTCAGCTGTGAATCTGTCTGG - Intronic
1079262233 11:18894200-18894222 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1079463219 11:20703107-20703129 AATTCAGCTGTGAATCTGTCTGG + Intronic
1080736956 11:35025510-35025532 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1080824808 11:35838927-35838949 AATACAGATGGGCATTTGAGAGG - Intergenic
1081171664 11:39877122-39877144 AATTCAGCTGTGAATCTGCCTGG - Intergenic
1082285569 11:50314264-50314286 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1083046386 11:59739652-59739674 AATTCAGCTGTGAATCTGTCTGG + Intronic
1083537523 11:63484182-63484204 AATTCAGCTGTGAATCTGTCTGG - Intronic
1084152268 11:67294310-67294332 CAGTCAGGTGGGATTCTGATAGG + Intronic
1084850557 11:71936320-71936342 AATTCAAATGGGAATCTGCCAGG - Intronic
1084946513 11:72641766-72641788 TGTTTGGGTGGGAATCTGAGCGG + Intronic
1085783327 11:79429257-79429279 ATTTCAGGTCAGACTCTGAGAGG - Intronic
1085856055 11:80177495-80177517 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1085990733 11:81840163-81840185 AATTCAAGCTGGGATCTGAGTGG + Intergenic
1086290455 11:85303141-85303163 AATTCAGGTGGGAATACAAAAGG - Intronic
1086475419 11:87167913-87167935 AATTCAGGTGTGAATCTGTCAGG + Intronic
1086610669 11:88751492-88751514 AATTCAGCTGTGAATCTGTCTGG - Intronic
1087213782 11:95472188-95472210 AATTCAGTTGTGAATCTGTCTGG + Intergenic
1087231610 11:95672330-95672352 TACTCAGGTGGGACACTGAGGGG - Intergenic
1087306077 11:96490486-96490508 AATTCAGCTGTGAATCTGTCTGG - Intronic
1087328513 11:96752497-96752519 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1087378806 11:97378492-97378514 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1087541747 11:99530610-99530632 AATTCAAGTTGGAATTTGGGTGG - Intronic
1087688661 11:101294418-101294440 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1087721543 11:101671467-101671489 AATTTGGGGGGGAATCTTAGTGG - Intronic
1087888107 11:103504013-103504035 AATTCAGCTGTGAATCTGTGTGG - Intergenic
1088368777 11:109066378-109066400 AAGGAAGGTGGGAATCTGGGTGG + Intergenic
1088402575 11:109437397-109437419 CATTCATATGAGAATCTGAGAGG + Intergenic
1088405207 11:109468564-109468586 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1089630006 11:119778619-119778641 GATTCAGGTGTGAATCTGCCCGG - Intergenic
1089703328 11:120259007-120259029 AATTGCAGTGGGAAGCTGAGGGG + Intronic
1090114934 11:123959171-123959193 AATTCAGCTGTGAATCTGTTTGG + Intergenic
1090751960 11:129754332-129754354 AATTCAGCTGTGAATCCGTGTGG - Intergenic
1090805594 11:130200131-130200153 GATTCAGGTGGGTCTCTGGGTGG + Exonic
1090812283 11:130255993-130256015 AATTCAGCTGTGAATCTGTCTGG - Intronic
1090847204 11:130540107-130540129 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1090864355 11:130684500-130684522 AATTCAGCTGTGAATCTGTCTGG + Intronic
1090929968 11:131288668-131288690 AATTCATGTTGGAGTCTTAGCGG - Intergenic
1092680691 12:10976952-10976974 AATTCAGCTGTGAATCTGTCTGG - Intronic
1092970636 12:13691374-13691396 AGTTCAGGTGGAAATCAGAAAGG + Intronic
1093242825 12:16698621-16698643 AATTCATGTGGGGAGTTGAGAGG + Intergenic
1093270065 12:17049605-17049627 AATTCAGCTGTGAATCTGCCTGG - Intergenic
1093336279 12:17908668-17908690 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1093604242 12:21070641-21070663 AATTCAGCTGTGAATCTGTCTGG + Intronic
1093659125 12:21734180-21734202 AATTCAGCTGTGAATCTGTTTGG + Intronic
1093664133 12:21792159-21792181 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1093951872 12:25171508-25171530 AATTCTGCTGTGAATCTGTGTGG - Intronic
1094139710 12:27168432-27168454 AATTCAGCTGTGAATCCGTGTGG + Intergenic
1094275659 12:28671952-28671974 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1095118402 12:38384288-38384310 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1095121117 12:38420669-38420691 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1095458498 12:42416005-42416027 AATTCAGGTAGGATTCTCATAGG + Intronic
1095564792 12:43610361-43610383 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1095920301 12:47523150-47523172 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1096925473 12:55139759-55139781 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1097370241 12:58769900-58769922 AATTCAGCTGTGAATCTGTCTGG - Intronic
1098054384 12:66489008-66489030 AATTCAGCTGTGAATCTGTCTGG - Intronic
1098686795 12:73432943-73432965 AATTCAGCTGTGAATCTGACTGG + Intergenic
1098791540 12:74830280-74830302 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1098839673 12:75463721-75463743 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1099025781 12:77462799-77462821 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1099031150 12:77527285-77527307 AATTCAGCTGTGAATCCGTGTGG - Intergenic
1099238623 12:80112859-80112881 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1099919059 12:88934485-88934507 AATTCAGGTGTGAAGTTGTGTGG + Intergenic
1100073997 12:90755857-90755879 AATTCAGGTTGAGATTTGAGTGG - Intergenic
1100136601 12:91560341-91560363 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1100248761 12:92792668-92792690 AATTCAGCTGTGAATCTGCCTGG - Intronic
1100950680 12:99845826-99845848 AATTCAGATGTGAAACTGTGTGG + Intronic
1101690715 12:107077790-107077812 GATTCAGGTTGGAATGTGAGGGG - Intronic
1103187137 12:118968627-118968649 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1106425821 13:29628296-29628318 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1106608459 13:31254064-31254086 AATTCAGCTGTGAATCTGTCTGG - Intronic
1106958579 13:34971947-34971969 AATTCAGCTGTGAATCTGTCTGG + Intronic
1106990764 13:35416841-35416863 AATTCAGCTGTGAATCTGTCTGG + Intronic
1107175972 13:37398555-37398577 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1107333806 13:39331763-39331785 AATTCAGCTGAGAATCTGTCCGG - Intergenic
1108136540 13:47368797-47368819 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1108906109 13:55476277-55476299 AATTCAGCTGGTATTTTGAGAGG + Intergenic
1109439495 13:62350556-62350578 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1109566028 13:64117490-64117512 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1109816528 13:67591911-67591933 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1110067884 13:71131872-71131894 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1110375731 13:74791706-74791728 AATTCAGGTGTAAATCTGTCTGG + Intergenic
1110767199 13:79294372-79294394 AATACAAGGGGGAATCAGAGAGG + Intergenic
1110942377 13:81366368-81366390 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1111565326 13:90006774-90006796 AATTCGGTTGGGAATTGGAGTGG - Intergenic
1112794393 13:103039645-103039667 AGTTGAGGTGGGAATCGGAGAGG + Intergenic
1113406915 13:110049818-110049840 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1113818781 13:113195411-113195433 GATACTGGTGGGAAGCTGAGGGG - Intronic
1114569499 14:23656689-23656711 TATTGAGGTGGGACTCTAAGAGG - Intergenic
1114706290 14:24730038-24730060 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1114771544 14:25432570-25432592 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1115843974 14:37505139-37505161 AATTCAGCTGTGAATCTGTCTGG - Intronic
1115877017 14:37872239-37872261 AATTCCGGTGAGAATGGGAGAGG + Intronic
1116161305 14:41269447-41269469 AATTCTGGTGGGAATCCAGGTGG + Intergenic
1116165761 14:41332462-41332484 AATTCAAGATGAAATCTGAGTGG + Intergenic
1116544774 14:46151217-46151239 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1116685391 14:48032735-48032757 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1117103525 14:52375241-52375263 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1117446969 14:55813329-55813351 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1118531838 14:66715081-66715103 AATTCAGCTGTGAATCTGTCTGG + Intronic
1118545038 14:66876782-66876804 AATTCAGCTGTGAATCTGTCTGG - Intronic
1118939907 14:70324049-70324071 AAACCAGGTGGGACTCTTAGAGG + Intergenic
1118958429 14:70504820-70504842 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1119416580 14:74474394-74474416 AACTCTGGTGGGAAGCTGAGGGG + Intergenic
1119802667 14:77459163-77459185 AATGCAAGTGCGAATCTGATAGG + Intronic
1120328440 14:83057149-83057171 AATTCTGACGGGAATCTGGGTGG + Intergenic
1120514877 14:85458824-85458846 AAATCAGGTGGGCATATTAGAGG + Intergenic
1120559338 14:85971642-85971664 AATTCGGCTGTGAATCTGACTGG + Intergenic
1120697988 14:87665703-87665725 AATACAGGTGGAAACCTAAGGGG + Intergenic
1120842828 14:89101387-89101409 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1121881012 14:97500188-97500210 AACTCGGGTGGGAATCAGATGGG + Intergenic
1202880677 14_KI270722v1_random:56633-56655 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1125507046 15:40272993-40273015 AAGTCAGGTGGGCAGCTGGGAGG + Exonic
1126244877 15:46492948-46492970 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1126552678 15:49950263-49950285 AATTCAGCTGTGAATCTGTCTGG + Intronic
1129030893 15:72616862-72616884 AACTCAGCTGGGAAACTGTGTGG - Intergenic
1129961477 15:79690653-79690675 AAGTCAGCTGGGATTCTGATAGG - Intergenic
1130172530 15:81530621-81530643 AATTCAGGTCAGAGTCTGTGTGG + Intergenic
1130800635 15:87259365-87259387 AATTCGGCTGTGAATCTGACTGG + Intergenic
1132254045 15:100359088-100359110 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1135169443 16:20170275-20170297 AATACAGGTGGGAAAATGTGAGG + Intergenic
1135489767 16:22899233-22899255 AATTCAGGCAGGAAACTGGGAGG + Intronic
1137966256 16:52936370-52936392 AATTCCAGTGGGTATTTGAGAGG - Intergenic
1138818194 16:60227136-60227158 AAGTCCTGTGGGAATGTGAGTGG + Intergenic
1138887229 16:61094233-61094255 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1139824019 16:69742764-69742786 AATTGAGGTGGGAATCAGGTGGG - Intronic
1140414935 16:74767828-74767850 AATTCAGGTGGAAAACTAAAAGG + Intronic
1142936687 17:3339876-3339898 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1146760543 17:35473757-35473779 AATTCAGCTGTGAATCTGTCTGG + Exonic
1146766513 17:35527247-35527269 AATTCAGCTGTGAATCTGTCTGG - Intronic
1147512958 17:41087948-41087970 AATTCTGAAGGGATTCTGAGTGG + Intronic
1148511834 17:48177630-48177652 AATTAAGAAGGGAATGTGAGGGG - Intronic
1148670144 17:49404231-49404253 AATTCCACTGGGTATCTGAGAGG + Exonic
1149093487 17:52813708-52813730 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1149193272 17:54089149-54089171 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1149410614 17:56402294-56402316 AATTCTGCTGAGAATCTGTGTGG + Intronic
1150094422 17:62360496-62360518 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1150874104 17:68949332-68949354 AATTCAGCTGTGAATCTGTCTGG - Intronic
1150881806 17:69038104-69038126 AATTCAGCTGTGAATCTGTTTGG - Intronic
1153071613 18:1112454-1112476 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1153313099 18:3696801-3696823 AATTCAGCTGTGAATCTGTCTGG + Intronic
1155769439 18:29678328-29678350 AATTCAAGTTGAAATTTGAGTGG - Intergenic
1155773458 18:29728283-29728305 AATTCATCAGGAAATCTGAGTGG - Intergenic
1155893108 18:31290522-31290544 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1156038806 18:32795894-32795916 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1156134338 18:34018670-34018692 AAGTCAGCTGGGAATGGGAGAGG + Intronic
1156512331 18:37648805-37648827 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1156896459 18:42252303-42252325 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1157064649 18:44333894-44333916 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1157066227 18:44353991-44354013 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1157561769 18:48652521-48652543 AATTCAGCTGTGAATCTGTCTGG - Intronic
1157601952 18:48898586-48898608 AAGTCAGCTGGGATTCTGACAGG - Intergenic
1157773096 18:50367563-50367585 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1158100696 18:53826764-53826786 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1158785582 18:60707868-60707890 AAATCATGAGAGAATCTGAGAGG - Intergenic
1159364483 18:67448222-67448244 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1159374912 18:67580730-67580752 AATTCAGGTAGTAATCGGAATGG + Intergenic
1159628099 18:70717826-70717848 AATTCGGCTGTGAATCTGTGTGG - Intergenic
1159646513 18:70924492-70924514 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1159693946 18:71529625-71529647 AATTCAGCTGTAAATCTGACTGG - Intergenic
1160286768 18:77550317-77550339 GATTCAGATTGGAATCTGTGAGG - Intergenic
1163075206 19:14884661-14884683 AATTCAGCTGTGAAACTGACTGG - Intergenic
1163914526 19:20228866-20228888 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1163963547 19:20721241-20721263 AATTCAGCTGTGAATCTGTCTGG + Intronic
1164139425 19:22444653-22444675 AATTCAGCTGTGAATCTGTCTGG + Intronic
1164213367 19:23119950-23119972 AATTCAGCTGTGAATCTGTCTGG + Intronic
1164316735 19:24095489-24095511 AATTCAGCTGTGAATCTGTCTGG + Intronic
1164688358 19:30187263-30187285 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1165583358 19:36889396-36889418 AATTCAGCTGTGAATCTGTCTGG + Exonic
1166260357 19:41635288-41635310 AATTCAGCTGTGAATCTGTCTGG + Intronic
1166428826 19:42704833-42704855 AATTCAGCTGTGAATCTGTCTGG + Intronic
1166816711 19:45550688-45550710 AAATCAGGAGGGAAACTGGGAGG - Intronic
1168568644 19:57445590-57445612 AGTTCAGATGGAAATCTGCGAGG + Intronic
1168578448 19:57533601-57533623 AATTCAGGAGGCACTCTGATAGG - Intronic
1202656287 1_KI270708v1_random:25737-25759 AATTCAGCTGTGAATCTGTCTGG - Intergenic
925218521 2:2118211-2118233 AATGAAGGTGGGAAACTGACAGG + Intronic
925301565 2:2817481-2817503 AATTCAGCTGTGAATCTGTCTGG + Intergenic
925819131 2:7782355-7782377 AATTCAGCTGTGAATCTGTCTGG + Intergenic
925974878 2:9135142-9135164 AATTCAGGTGAGAAGGTGTGAGG + Intergenic
926448784 2:12976512-12976534 AATACATTTGGGAATCAGAGAGG - Intergenic
926450645 2:12999941-12999963 AATTCAGCTGGGAAACTTTGGGG + Intergenic
926566688 2:14483393-14483415 AATTCAGTTGTGAATCTGTCTGG - Intergenic
927076557 2:19584145-19584167 AATTCAGTTGTGAATCTGTCTGG - Intergenic
928474241 2:31609248-31609270 AAGTCAGCTGGGATTCTGACAGG - Intergenic
928750984 2:34470044-34470066 AATTCAGCTGTGAATCTGTCTGG - Intergenic
929062582 2:37938498-37938520 AATTCAGCTGTGAATCTGTGTGG + Intronic
929343662 2:40854561-40854583 AATTCAGCTGTGAATCTGTCTGG - Intergenic
930192800 2:48477761-48477783 AAGTCAGTTGGGATTCTGATAGG + Intronic
930216674 2:48704493-48704515 AATTCAGCTGTGAATCTGCCTGG + Intronic
930440211 2:51395026-51395048 AATTCAGCTGCGAATCTGTCTGG - Intergenic
930451115 2:51539587-51539609 AATGCAGGTGAAAATTTGAGAGG - Intergenic
930900355 2:56499185-56499207 AATTCAGCTGTGAATCTGTCTGG + Intergenic
930965352 2:57317158-57317180 AATTCAGCTGTGAATCTGTCTGG - Intergenic
931112396 2:59125450-59125472 AATTCAGCTGTGAATCTGTCTGG + Intergenic
931594828 2:63930050-63930072 AATTCAGCTGTGAATCTGTCTGG - Intronic
932267495 2:70380957-70380979 AAATCAGTTGGGATTCTGATAGG + Intergenic
932398314 2:71463152-71463174 AGCTCAGGAGGGAAGCTGAGGGG - Intronic
932523735 2:72441790-72441812 AATTCAGCTGTGAATCTGTCTGG - Intronic
933094710 2:78163608-78163630 AATTCAGCTGTGAATCTGTCTGG - Intergenic
933115193 2:78460194-78460216 AATTCAGTTGTGAATCTGTCTGG - Intergenic
933604303 2:84365726-84365748 AATTCAGCTGTGAATCTGTCTGG - Intergenic
934812879 2:97298576-97298598 AATTGAGCTGTGAATCTGTGTGG - Intergenic
934824816 2:97409904-97409926 AATTGAGCTGTGAATCTGTGTGG + Intergenic
934953536 2:98596493-98596515 AAATCAGTTGGGAATTTGATGGG - Intergenic
935319580 2:101872701-101872723 TGTTCAGGTGGGAAGCTTAGGGG + Intronic
935567632 2:104626323-104626345 AATTCAGCTGTGAATCTGTCTGG + Intergenic
936032519 2:109083751-109083773 ACTGCAGGTGGGAATGTAAGAGG - Intergenic
936910871 2:117591951-117591973 AATTCAGCTGTGAATCTGTCTGG + Intergenic
937065344 2:119012970-119012992 AATTCAGGTGGGGCTCCCAGGGG - Intergenic
937466565 2:122138037-122138059 AATTCAAGATGAAATCTGAGTGG + Intergenic
937971729 2:127554681-127554703 AATTCAGCTGTGAATCTGTCTGG + Intronic
938256144 2:129861497-129861519 AATTCAGTTTGGGATCTGGGTGG - Intergenic
938674828 2:133621671-133621693 AATTCAGCTGTGAATCTGTCTGG - Intergenic
939019635 2:136943485-136943507 AATTCAGCTGTGAATCTGTCTGG + Intronic
939160016 2:138576694-138576716 AATTCAGCTGTGAATCTGTCTGG + Intergenic
939219603 2:139284788-139284810 AATTCAGCTGTGAATCTGTCTGG - Intergenic
939753365 2:146076807-146076829 AATTCAGCTGTGAATCTGTCTGG - Intergenic
939809291 2:146811406-146811428 AATTCAGCTGTGAATCTGTCTGG - Intergenic
940395450 2:153185065-153185087 AATTCAGCTGTGAATCTGTTTGG + Intergenic
940433972 2:153628950-153628972 AATTCAGCTGTGAATCTGTCTGG + Intergenic
940708217 2:157130167-157130189 AATTCAGCTGTGAATCTGTCTGG - Intergenic
940758274 2:157708014-157708036 AATTCAGCTGTGAATCTGTCTGG - Intergenic
940964837 2:159825495-159825517 AATTCAGCTGTGAATCTGTCTGG - Intronic
941845640 2:170129460-170129482 AATTCAGCTGTGAATCTGTCTGG - Intergenic
941953493 2:171180280-171180302 AATTCAGGTCCTAATCTGATAGG + Intronic
942089886 2:172479768-172479790 AGTGGAGGTGGGAAACTGAGGGG - Intronic
942429373 2:175893873-175893895 AATTCAGCTGTGAATCTGTCTGG - Intergenic
942780219 2:179633090-179633112 AATTCAGCTGTGAATCTGTCTGG - Intronic
942829022 2:180216652-180216674 AATTCAGCTGTGAATCTGTCTGG - Intergenic
943152789 2:184135434-184135456 AATTCAGCTGTGAATCTGTCTGG + Intergenic
943161973 2:184266075-184266097 AATTCAGCTGTGAATCTGTCTGG - Intergenic
943274518 2:185849586-185849608 AATTCAGCTGTGAATCTGTCTGG - Intergenic
943384690 2:187186603-187186625 AATTCGGCTGTGAATCTGTGTGG + Intergenic
943946399 2:194071057-194071079 AATTCAGCTGTGAATCTGTCTGG + Intergenic
943978531 2:194514694-194514716 AATGGTGGTGGGAATCAGAGAGG + Intergenic
944072918 2:195693425-195693447 AATTCAGCTGTGAATCTGTCTGG + Intronic
944107272 2:196092694-196092716 AATTCAGCTGTGAATCTGTCTGG - Intergenic
944169109 2:196755236-196755258 AATTCAGCTGTGAATCTGTCTGG + Intronic
944455534 2:199890125-199890147 AATTCAGGTGTGAATCTGTCTGG - Intergenic
944922067 2:204425377-204425399 AATTCAGCTGTGAATCTCTGTGG - Intergenic
945363615 2:208923953-208923975 AATTCAGCTGTGAATCTATGTGG + Intergenic
945496106 2:210508917-210508939 AATTCAGCTGTGAATCTGTCTGG - Intronic
945533185 2:210981399-210981421 AATTCAGCTGTGAATCTGTCTGG + Intergenic
945615258 2:212058327-212058349 AATTCAGCTGTGAATCTGTCTGG - Intronic
945657527 2:212643819-212643841 AATTCAGCTGTGAATCTGTCTGG + Intergenic
945820539 2:214659249-214659271 AATTCAGCTGTGAATCTGTCTGG + Intergenic
946896276 2:224327717-224327739 AAGGCAGGAGGGAATCTGAGAGG - Intergenic
1169314393 20:4576460-4576482 AATTCAAGATGGAATTTGAGTGG - Intergenic
1169616439 20:7451645-7451667 GATTCATGTGTGAATCTGAGTGG + Intergenic
1169841043 20:9938024-9938046 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1169978867 20:11361151-11361173 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1169980920 20:11383076-11383098 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1170001145 20:11615680-11615702 AATTCCAGTGGGTATTTGAGAGG + Intergenic
1170294561 20:14809975-14809997 AATTCAGCTGTGAATCTGTCTGG - Intronic
1170492446 20:16892147-16892169 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1170651114 20:18242785-18242807 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1170730308 20:18968985-18969007 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1170978677 20:21190447-21190469 AATTCAACTGGGAACCAGAGAGG - Intronic
1171141409 20:22747012-22747034 ACTTCAGGTGGGAACCTAACAGG - Intergenic
1171204206 20:23266582-23266604 TATTCAGGAGGTAATCTGGGAGG + Intergenic
1171239876 20:23557388-23557410 AATTCAGCTGTGAATCTGTTTGG + Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173260119 20:41426843-41426865 AATTCAGGTGGGAATCTGAGGGG + Intronic
1173361882 20:42352088-42352110 AATTTTGGTGGCAATCCGAGTGG + Exonic
1173868197 20:46326271-46326293 ATTTCAGGTGGCAATCAGAGTGG - Intergenic
1174124809 20:48296540-48296562 AGTTCAGGTGTGATTCTCAGAGG + Intergenic
1174949425 20:55028336-55028358 AATTCTGGTGGGAATCAGGGTGG - Intergenic
1175225843 20:57443356-57443378 AATTCTGCTTGGAATCTCAGAGG - Intergenic
1175265681 20:57702066-57702088 ATTTCAGAAGGGAAGCTGAGAGG - Intronic
1176743989 21:10634603-10634625 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1177022687 21:15883004-15883026 AATTCATCTGGGAATCTGCCTGG + Intergenic
1177043667 21:16144157-16144179 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1177313534 21:19427697-19427719 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1177314990 21:19448232-19448254 AATTCAGTTGTGGATCTGTGTGG - Intergenic
1181045972 22:20214418-20214440 CCTGCAGGCGGGAATCTGAGCGG - Intergenic
1181293788 22:21818869-21818891 AATCCAGGTGAAAAACTGAGAGG + Intronic
1181360881 22:22334293-22334315 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1181683608 22:24513679-24513701 GATTCAGGCGGGACTCTCAGAGG + Intronic
1183002711 22:34874961-34874983 AATACAGCTGGGGATCTGGGAGG + Intergenic
1184263062 22:43330373-43330395 AATTCAGGAGGGCTTCTTAGAGG - Intronic
1184860838 22:47172567-47172589 AATTCAGGTAGGATTCTCATAGG - Intronic
1185231605 22:49687068-49687090 AATTCAGGTCTGACTCTGTGGGG + Intergenic
949139355 3:613075-613097 AATTCAGCTGTGAATCTGTCTGG + Intergenic
949287741 3:2426674-2426696 AATTCAGCTGTGAATCTGTCTGG + Intronic
949592923 3:5512364-5512386 AATTCAGCTGTGAATCTGTCTGG - Intergenic
950160153 3:10754383-10754405 ATTTGAGGTTGGAATCTCAGAGG - Intergenic
950561654 3:13732999-13733021 AATTCAGCTGTGAATCTGTCTGG + Intergenic
950619369 3:14191387-14191409 AATTCAGCTGTGAATCTGTCTGG + Intronic
951452631 3:22856218-22856240 AATTCAGCTGTGAATCTGTCTGG + Intergenic
951672632 3:25202038-25202060 AATTCAGCTGTGAATCTGTCTGG + Intronic
952714639 3:36467447-36467469 AATTCAGCTATGAATCTGTGCGG + Intronic
952732777 3:36656717-36656739 AATTCAGCTGTGAATCTGTCTGG - Intergenic
953185567 3:40634839-40634861 AATTCAGCTGTGAATCTGTCTGG - Intergenic
953277017 3:41511678-41511700 AATTCAGTTGTGAATCTGTCTGG - Intronic
953433728 3:42861400-42861422 AATTCAGCTGTGAATCTGCCTGG - Intronic
953523200 3:43662929-43662951 AATTCAGCTGTGAATCTGTCTGG - Intronic
954488739 3:50880664-50880686 AATTCAGCTGTGAATCTGTCTGG - Intronic
955492340 3:59495824-59495846 AATTCAGCTGTGAATCTGCCTGG + Intergenic
956486879 3:69732194-69732216 AACTCAGGGGGTGATCTGAGAGG + Intergenic
956584376 3:70848836-70848858 AATTCAGCTGTGAATCTGTCTGG + Intergenic
957293257 3:78305273-78305295 AATTCATGTGTGTATCTTAGGGG - Intergenic
957353094 3:79051444-79051466 AATTCAGCTGTGAATCTGTCTGG - Intronic
957489763 3:80908544-80908566 AATTCAGCTGTGAATCTGTCTGG - Intergenic
957626695 3:82661565-82661587 AATTCAGCTGTGAATCTGTCTGG + Intergenic
957667058 3:83246251-83246273 AATTCAGCTGTGAATCTGTCTGG + Intergenic
957750270 3:84405677-84405699 AATTCAGCTGGGAATCCGTCTGG + Intergenic
957751163 3:84418026-84418048 AATTCAGGATGGGATTTGAGTGG - Intergenic
958081407 3:88750436-88750458 AATTCAGCTGTGAATCTGTCTGG - Intergenic
958480034 3:94634170-94634192 AATTCAGCTGTGAATCTGTCTGG - Intergenic
958769109 3:98405550-98405572 AATTCAGCTGTGAATCTGTCTGG - Intergenic
958817835 3:98936181-98936203 AATTCAGCTGTGAATCTGTCTGG - Intergenic
958904653 3:99928404-99928426 CATGGAGGTGGGAATGTGAGAGG + Intronic
959561336 3:107786271-107786293 AAGTCAGCTGGGATTCTAAGAGG - Intronic
959730923 3:109601308-109601330 AATTCAGCTGTGAATCTGTCTGG + Intergenic
959998756 3:112708091-112708113 AATTCAGCTGTGAATCTGTCTGG + Intergenic
960765830 3:121128718-121128740 AAATAAGGTGGGAAGCTGACTGG + Intronic
960977773 3:123192779-123192801 AATTCAGGAGTCAATCTTAGTGG - Intronic
961738261 3:129015681-129015703 AATTCAGGTAGGGACCAGAGAGG + Intronic
962175248 3:133146568-133146590 AATTCAGCTGTGAATCTGTCTGG + Intronic
962645414 3:137434043-137434065 AATTCAGCTGTGAATCTGTCTGG - Intergenic
962833855 3:139169073-139169095 AATTCGGCTGGGAATCTGTCTGG + Intronic
963187662 3:142437375-142437397 AGTTCTGTTGGGAAACTGAGGGG - Intronic
963628971 3:147709723-147709745 AATTCAGCTGTGAATCTGTCTGG + Intergenic
963736313 3:149021099-149021121 AATGCAGGTGGGATTTTCAGAGG - Intronic
963849794 3:150199835-150199857 GAACCACGTGGGAATCTGAGGGG - Intergenic
963913577 3:150837020-150837042 AATTCAGCTGTGAATCTGTCTGG + Intergenic
964511542 3:157457968-157457990 AATTCAGCTGTGAATCTGTCTGG + Intronic
964905152 3:161710585-161710607 AATTCAGCTGTGAATCTGCCTGG - Intergenic
965163555 3:165166400-165166422 AATTCAGCTGTGAATCTGTCTGG + Intergenic
965278382 3:166717456-166717478 AATTCAGCTGTGAATCTGTCTGG - Intergenic
965497719 3:169418286-169418308 AATTCAGCTGTGAATCTGTCTGG - Intronic
966250177 3:177857075-177857097 AATTCAGCTGTGAATCTGTCTGG + Intergenic
966536723 3:181043340-181043362 AATTCAGCTGTGAATCTGTCTGG + Intergenic
967396258 3:189012599-189012621 AATTCAGCTGTGAATCTGCCTGG + Intronic
967768673 3:193310555-193310577 AATTCAGGTGTGAGTCAGAATGG - Intronic
968503984 4:963619-963641 AATCCACGTGGGACTCTGCGTGG + Intronic
968947243 4:3671502-3671524 AAGTCAGCTGGGATTCTGATGGG + Intergenic
970101495 4:12527683-12527705 AATTCAGCTGTGAATCTGTATGG - Intergenic
970478309 4:16447970-16447992 AATTCAAGTAGGAATATAAGAGG - Intergenic
970685560 4:18562931-18562953 AATTCGGCTGTGAATCTGTGTGG - Intergenic
971149382 4:24014946-24014968 TAGACAGGTGGGAATCTCAGGGG + Intergenic
971576701 4:28283996-28284018 AATTCAGCTGTGAATCTGTCTGG - Intergenic
971938280 4:33182120-33182142 AATTCAGCTGCGAATCTGTCTGG + Intergenic
972136007 4:35895066-35895088 AATTCAGCTGTGAATCTGTCTGG - Intergenic
972188240 4:36558529-36558551 AATTCAGCTGTAAATCTGTGTGG - Intergenic
972351794 4:38243003-38243025 CTTTCAGGCAGGAATCTGAGAGG + Intergenic
972449388 4:39181710-39181732 ACATCAGGTAGGAATCTGATTGG - Intergenic
972965034 4:44499013-44499035 AATTCAGCTGTGAATCTGTCTGG + Intergenic
973093409 4:46166325-46166347 AATTCGGCTGTGAATCTGTGTGG + Intergenic
973284471 4:48400106-48400128 AATTCAGCTGTGAATCTGTCTGG + Intronic
973530024 4:51827509-51827531 AATTCAGCTGTGAATCTGTCTGG + Intergenic
973542674 4:51950097-51950119 AATTCAGCTGTGAATCTGTCTGG + Intergenic
973629430 4:52805536-52805558 AATTCAGCTGTGAATCTGTCTGG - Intergenic
974127955 4:57718664-57718686 AATTCAGCTGTGAATCTGTCTGG - Intergenic
974261130 4:59525417-59525439 AATTCAGTTGTGAATCTGTCTGG + Intergenic
974309768 4:60190153-60190175 AATTCAGCTGTGAATCTGTCTGG - Intergenic
974325996 4:60415990-60416012 AATTCAGCTGTGAATCTGTCTGG + Intergenic
974690075 4:65287213-65287235 AATTCAAGAGGAAATTTGAGTGG + Intergenic
975040701 4:69742472-69742494 AATTCAGCTGTGAATCTGTCTGG + Intronic
975104537 4:70553137-70553159 AATACAAGTGTGAATCTTAGTGG + Intergenic
975153800 4:71048602-71048624 AATTCAGCTGTGAATCTGTCTGG - Intergenic
975290645 4:72674197-72674219 AATTCAGCTGTGAATCTGTCTGG + Intergenic
975308042 4:72871403-72871425 AATTCAGCTGTGAATCTGTCTGG - Intergenic
975522608 4:75316958-75316980 AATTCAGCTGCGAATCTGTCTGG - Intergenic
975977814 4:80119102-80119124 AATTCAGCTGTGAATCTGTCTGG - Intronic
976159036 4:82178927-82178949 AATTCAGCTGTGAATCTGTCTGG - Intergenic
976462220 4:85325665-85325687 AATTCAGCTGTGAATCTGTCTGG - Intergenic
976534000 4:86190349-86190371 AATTCAGCTGTGAATCTGTCTGG + Intronic
976655601 4:87485669-87485691 AATTCAGCTGTGAATCTGTCTGG + Intronic
976809593 4:89086712-89086734 AATTCAGTTGTGAATCTGTCTGG + Intronic
976941860 4:90711934-90711956 AATTCAGCTGTGAATCTGTCTGG + Intronic
977444872 4:97118298-97118320 AATTCAGCTGTGAATCTGTCTGG - Intergenic
977549603 4:98426756-98426778 AATTCAGCTGTGAATCTGTCTGG - Intronic
977735146 4:100405826-100405848 AATTCAGCTGTGAATCTGTCTGG + Intronic
977906862 4:102486984-102487006 AATTCAGTTGCGAATCTGTCTGG - Intergenic
977962390 4:103100715-103100737 AATGCAGGTGGGAATTTCTGAGG + Intergenic
978158226 4:105513869-105513891 AATTCAGCTGTGAATCTGTCTGG + Intergenic
978185692 4:105854699-105854721 AATTCAGCTGTGAATCTGCCTGG + Intronic
978551260 4:109929891-109929913 AATTCAAGATGGAATTTGAGTGG - Intronic
978705326 4:111702237-111702259 AATTGAGGAGAGAATCAGAGTGG - Intergenic
979068189 4:116166400-116166422 AATTCAGGTGTGAATCTGTCTGG + Intergenic
979097282 4:116566585-116566607 AATTCAGCTGTGAATCTGTCTGG - Intergenic
979159748 4:117444914-117444936 AATTCAGCTGTGAATCTGTCTGG + Intergenic
979513417 4:121579936-121579958 AATTCATGTGGGAATGTAATAGG + Intergenic
979584580 4:122400608-122400630 AATTCAGCTGTGAATCTGTTCGG + Intronic
979628208 4:122870432-122870454 AATTCAGCTGTGAATCTGTCTGG + Intronic
980477578 4:133337476-133337498 AATTCAGCTGTGAATCTGTTTGG + Intergenic
980720288 4:136686780-136686802 AATTCAAGTTGAAATTTGAGTGG + Intergenic
981247648 4:142558581-142558603 AATTCATCTGGAAATCTCAGTGG + Intronic
981438741 4:144757843-144757865 AATTCAGCTGTGAATCTGTCTGG - Intergenic
981479713 4:145225681-145225703 AATTCAGCTGTGAATCTGTCTGG + Intergenic
982232802 4:153224094-153224116 AAATCAAGTGGAAATTTGAGAGG - Intronic
982804183 4:159742800-159742822 AATTCAGCTGTGAATCTGTCTGG + Intergenic
983071531 4:163273555-163273577 AATTCAGATGGGAGTCAGAGGGG + Intergenic
983841186 4:172458751-172458773 AATTCAGCTGTGAATCTGTCTGG - Intronic
984216122 4:176914564-176914586 AATTCAGCTGTGAATCTGTCTGG - Intergenic
984283516 4:177701103-177701125 AATTCAGCTGTGAATCTGTCTGG + Intergenic
984335383 4:178382845-178382867 AATTCAGCTGTGAATCTGTCTGG - Intergenic
984577384 4:181466818-181466840 AATTCAGATGTAAATATGAGGGG - Intergenic
984625782 4:182006331-182006353 AATTCAGCTGTGAATCTGTCTGG + Intergenic
985186384 4:187320897-187320919 AATTCAGCTGTGAATCTGTCTGG - Intergenic
985473478 5:62706-62728 AATTCAGCTGTGAATCTGTCTGG + Intergenic
986259283 5:6129348-6129370 AATTCAGCTGTGAATCTGTCTGG - Intergenic
986276926 5:6283901-6283923 AATTCAGAAGGGAAGTTGAGAGG + Intergenic
986418077 5:7548078-7548100 ATTTCAGGGCTGAATCTGAGCGG + Intronic
986753860 5:10815491-10815513 AATTCAGCTGTGAATCTGTCTGG - Intergenic
987180212 5:15359656-15359678 AATTCAGCTGTGAATCTGTCTGG - Intergenic
987400717 5:17473352-17473374 AATTCAGCTGTGAATCTGTCTGG - Intergenic
987444888 5:18005376-18005398 AATTCAGCTGTGAATCTGTCTGG + Intergenic
987530895 5:19118027-19118049 AATTCAGCTGTGAATCTCTGTGG - Intergenic
987649789 5:20725973-20725995 AATTCAGCTGTGAATCTGTCTGG - Intergenic
987678284 5:21104015-21104037 AATCCAGGTGGGAATGTGCTAGG + Intergenic
988221518 5:28352570-28352592 AATTCAGTTGTGAATCTGTCTGG - Intergenic
988667953 5:33350766-33350788 AATTCAGCTGTGAATCTGTCTGG + Intergenic
988745769 5:34135523-34135545 AATTCAGCTGTGAATCTGTCTGG + Intergenic
988929429 5:36022006-36022028 AATTCAGCTGTGAATCTGTCTGG + Intergenic
989683921 5:44062494-44062516 AATTCAGCTGTGAATCTGTCTGG + Intergenic
990134298 5:52626762-52626784 AATTCAGCTGTGAATCTGTCTGG + Intergenic
990135280 5:52637391-52637413 AAGTAAAGTGGGCATCTGAGAGG - Intergenic
990659590 5:57998459-57998481 AATTCAGCTGTGAATCTGTCTGG - Intergenic
990750765 5:59013682-59013704 AATTCAGCTGTGAATCTGTCTGG - Intronic
990838806 5:60052077-60052099 AATTCAGTTGTGAATCTGTCTGG - Intronic
990841177 5:60080983-60081005 AATTCAGCTGGGAATCAGTCTGG + Intronic
991296465 5:65086419-65086441 AATTCAGGAGTGAAGCTGTGTGG + Intergenic
991576158 5:68105767-68105789 AATTCAGCTGTGAATCTGTCTGG - Intergenic
992288252 5:75257851-75257873 AATTCAGCTGTGAATCTGTCTGG - Intergenic
993284213 5:85969271-85969293 AATTCAGCTGGGAATCTATCTGG + Intergenic
993494298 5:88590142-88590164 AATTCAGCTGTGAATCTGTCTGG - Intergenic
993751857 5:91679201-91679223 AATTCAGCTGTGAATCTGTCTGG + Intergenic
993785866 5:92134748-92134770 AATTCAGCTGTGAATCTGTCTGG + Intergenic
993892076 5:93486633-93486655 AATTCAGCTGTGAATCTGTTTGG - Intergenic
994227572 5:97270983-97271005 AATTCAGCTGTGAATCTGTGTGG + Intergenic
994277688 5:97858557-97858579 AATTCAGCTGTGAATCTGTCTGG - Intergenic
994452636 5:99961519-99961541 AATTCAGCTGTGAATCTGTCTGG + Intergenic
994646039 5:102470263-102470285 AATTCAGTTGTGAATCTGTCTGG + Intronic
994823509 5:104682523-104682545 AATTCAGCTGTGAATCTGTCTGG - Intergenic
994850712 5:105051833-105051855 AATTCAGCTGTGAATCTGTCTGG + Intergenic
995188288 5:109294063-109294085 AATTCAGCTGTGAATCTGCCTGG - Intergenic
995690071 5:114815771-114815793 AATTCAGCTGTGAATCTGTCTGG + Intergenic
995699695 5:114920736-114920758 AATTCAGGTGTGAATCAGTCTGG - Intergenic
995816047 5:116169385-116169407 AATTCAGCTATGAATCTGTGTGG - Intronic
995905157 5:117114399-117114421 AATTCAGCTGTGAATCTGTCTGG + Intergenic
996194950 5:120593539-120593561 AATTCAGGTGTGAATCCAACTGG - Intronic
996616145 5:125443431-125443453 AATTCAGCTGTGAATCTGACTGG - Intergenic
998746318 5:145263878-145263900 AATTCAGCTGTGAATCTGTCTGG - Intergenic
999958878 5:156732695-156732717 AATTCAGCTGTGAATCTGTCTGG + Intronic
1000134512 5:158333955-158333977 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1000595975 5:163215500-163215522 AATTCGGGTGTGAATCTGTTTGG - Intergenic
1000660847 5:163936377-163936399 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1000798036 5:165690002-165690024 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1001693491 5:173650932-173650954 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1003165569 6:3674813-3674835 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1003469488 6:6416138-6416160 AACCTAGGAGGGAATCTGAGTGG + Intergenic
1003803127 6:9694093-9694115 AATTCAGCTGTGAATCTGTCTGG - Intronic
1003971317 6:11302403-11302425 AATTCAGCTGTGAATCTGTCTGG - Intronic
1004825949 6:19421478-19421500 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1005274526 6:24202022-24202044 AATTCAGCTGTGAATCTGCCTGG - Intronic
1005543929 6:26843758-26843780 AATTCAGTTGTGAATCTGTCTGG + Intergenic
1005791294 6:29304077-29304099 TATACAGGTAGGAAACTGAGGGG + Intergenic
1006404332 6:33835354-33835376 AGAGCAGGTGGGAAGCTGAGGGG + Intergenic
1007159271 6:39775598-39775620 TATTCAGGTCAGAGTCTGAGGGG - Intergenic
1007509619 6:42365026-42365048 AGGGCAGGTGGGAACCTGAGTGG + Intronic
1008223833 6:48887347-48887369 AAAATAGGTAGGAATCTGAGAGG - Intergenic
1008529680 6:52444893-52444915 AATTCGGGTGTGAATCTGTCTGG + Intronic
1008773275 6:55005650-55005672 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1008896756 6:56565494-56565516 AATTCAGCTGTGAATCTGTCTGG + Intronic
1009014709 6:57885428-57885450 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1009247929 6:61262525-61262547 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1009446484 6:63748590-63748612 AATTCAGCTGTGAATCTGTCTGG + Intronic
1009449267 6:63782354-63782376 AATTCAGCTGTGAATCTGTCTGG + Intronic
1009599121 6:65775191-65775213 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1009799976 6:68524747-68524769 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1010518089 6:76799430-76799452 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1010555960 6:77280029-77280051 AATTCAGCTGTGAATCTGTTTGG - Intergenic
1010648442 6:78422541-78422563 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1010858125 6:80869108-80869130 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1010995494 6:82527625-82527647 AAGTCAGGTGGGTTTCTGACAGG + Intergenic
1011020325 6:82805813-82805835 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1011283173 6:85697389-85697411 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1011446553 6:87447782-87447804 AATTCAGCTGGAAATCTGTCTGG + Intronic
1011578541 6:88830975-88830997 AATTCAGCTGTGAATCTGTCCGG - Intronic
1011625032 6:89275695-89275717 AATTCAGGAGGGGAATTGAGAGG + Intronic
1011766583 6:90626639-90626661 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1011965554 6:93153155-93153177 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1012148835 6:95720117-95720139 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1012207068 6:96474678-96474700 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1012313937 6:97761878-97761900 AATTCAAGAGAGATTCTGAGTGG - Intergenic
1012587587 6:100942795-100942817 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1012688637 6:102285813-102285835 AATTCAGCTGTGAATCTGTGTGG - Intergenic
1012746621 6:103099046-103099068 AATTCAGCTGTGAATCTGTGTGG - Intergenic
1012814203 6:104001631-104001653 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1012834213 6:104244710-104244732 AATTCAGCTGTGAATCTGAGTGG - Intergenic
1013393425 6:109710559-109710581 AATTCAGCTTGGAATCTGTCTGG + Intronic
1013629663 6:111973988-111974010 AATACAGGTGGGTATATGGGTGG - Intergenic
1013741652 6:113294346-113294368 AATTCAGCTGTGAATCTGTTTGG - Intergenic
1013841271 6:114397288-114397310 GATTAGGGTGTGAATCTGAGTGG - Intergenic
1014128167 6:117801285-117801307 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1014128781 6:117807577-117807599 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1014433258 6:121393925-121393947 AATTCAGGAAGGAATTAGAGTGG - Intergenic
1015232615 6:130933715-130933737 AAGGCAGGCTGGAATCTGAGAGG + Intronic
1015247877 6:131095183-131095205 AATTCAGCTGTGAATCTGTTTGG - Intergenic
1015386389 6:132629035-132629057 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1015472180 6:133618143-133618165 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1015508235 6:134011226-134011248 AATTCAAATGTGAATTTGAGAGG + Intronic
1015679158 6:135784685-135784707 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1016227668 6:141759983-141760005 AATTCAGCTGTGAATCTGTGTGG + Intergenic
1016288685 6:142504256-142504278 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1016618870 6:146083837-146083859 AATTCAGCTGTGAATCTGTCTGG + Intronic
1016999287 6:149984732-149984754 AATTCCGTTGGGTATTTGAGAGG + Intergenic
1017008313 6:150044094-150044116 AATTCCGTTGGGTATTTGAGAGG - Intergenic
1017221619 6:151972190-151972212 AATTTAGCTGTGAATCTGTGTGG - Intronic
1017305338 6:152911791-152911813 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1017556046 6:155569890-155569912 AATTCAGCTGTGAATCTGTCGGG + Intergenic
1017724684 6:157268717-157268739 AACTCAGGTGGGATTCTTATGGG - Intergenic
1018168470 6:161123831-161123853 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1018806161 6:167262140-167262162 AATTCAGCTGTGAATCTCTGTGG - Intergenic
1020923698 7:14297093-14297115 AATTCAGCTGTGAATCTGTCTGG - Intronic
1021004687 7:15379640-15379662 AATTCAGCTGTGAATCTGTCTGG - Intronic
1021166675 7:17351066-17351088 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1021358339 7:19682283-19682305 AATTCAGGATGAGATCTGAGTGG - Intergenic
1021379594 7:19951321-19951343 AATTCGGCTGTGAATCTGACTGG + Intergenic
1021464347 7:20924957-20924979 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1021766852 7:23958226-23958248 GAGTCCGGTTGGAATCTGAGTGG - Intergenic
1021824438 7:24534218-24534240 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1022890589 7:34693530-34693552 AATTCAGCTGTGAATCTGTCTGG - Intronic
1023143253 7:37123674-37123696 AATTCAGCTGTGAATCTGTCTGG - Intronic
1023238638 7:38117886-38117908 AATTCAGGTGTGAATCCGTCTGG + Intergenic
1023632473 7:42178060-42178082 TATTCAGCTGAGAATCTGAGGGG + Intronic
1023657360 7:42437799-42437821 AATTCAGCTTTGAATCTGACTGG + Intergenic
1023697374 7:42861716-42861738 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1023822737 7:43988905-43988927 AGATGAGGTGGGAGTCTGAGAGG - Intergenic
1024078921 7:45839540-45839562 AATTCAGGTGGGACTTTAAATGG - Intergenic
1024397381 7:48885475-48885497 AATTCAGCTGTGAATCCGTGTGG - Intergenic
1024495841 7:50044701-50044723 AATTCAGCTGTGAATCTGTCTGG - Intronic
1027451791 7:78340343-78340365 AATTCAGCTGTGAATCTGTCTGG - Intronic
1027574802 7:79918593-79918615 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1027871527 7:83714005-83714027 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1028627633 7:92895325-92895347 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1028776118 7:94678670-94678692 AATTCAGCTGTGAATCTGACTGG + Intergenic
1028858180 7:95616078-95616100 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1029008981 7:97238975-97238997 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1029039807 7:97561059-97561081 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1029129913 7:98322114-98322136 AATTCTAGTGGGGAACTGAGAGG + Intronic
1029174586 7:98655683-98655705 AATTCAGGAGGGAAACAGTGGGG + Intergenic
1029483861 7:100827643-100827665 AATTCATGAGGGAAGCGGAGAGG + Intronic
1029751002 7:102542320-102542342 AGATGAGGTGGGAGTCTGAGAGG - Intronic
1029768955 7:102641431-102641453 AGATGAGGTGGGAGTCTGAGAGG - Intronic
1030132397 7:106213485-106213507 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1030612252 7:111702541-111702563 AATTCAGCTGGGAATCTGTCTGG + Intergenic
1030701251 7:112643692-112643714 AATTCAGCTGTGAATCTGTGTGG + Intergenic
1030939517 7:115629037-115629059 AACTCAGTTGGTAATATGAGTGG - Intergenic
1030958975 7:115890868-115890890 AATTCAGTTGTGAATCTGTCTGG - Intergenic
1030972591 7:116078721-116078743 AATTCAGCTGTGAATCTGTCTGG - Intronic
1031611675 7:123835183-123835205 AATTCAGCTGTGAATCTGTCTGG + Intronic
1031651858 7:124301301-124301323 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1031703009 7:124948359-124948381 AATTCAGCTGTGAATCTGCCTGG - Intergenic
1031891539 7:127299591-127299613 AATTCAGCTGTGAATCTGTTTGG - Intergenic
1032309205 7:130767032-130767054 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1032537380 7:132675998-132676020 AATTCAGCTGTGAATCTGTCTGG + Intronic
1032922176 7:136561487-136561509 AATTCAGCTGTGAATCTGTTGGG + Intergenic
1033651981 7:143350752-143350774 AATAGAGAAGGGAATCTGAGGGG - Intronic
1034370469 7:150591337-150591359 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1038243015 8:25827799-25827821 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1038572844 8:28677882-28677904 AATACTGTTGGGATTCTGAGAGG + Intronic
1039658113 8:39432876-39432898 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1040355268 8:46611400-46611422 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1040442542 8:47459241-47459263 AATTCAGCTGTGAATCTGTCTGG + Intronic
1040443300 8:47467251-47467273 AATTCAGCTGTGAATCTGTCTGG - Intronic
1040639579 8:49317646-49317668 ACTTCAGGTGCAAATCTCAGTGG - Intergenic
1040760461 8:50835772-50835794 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1041025426 8:53681012-53681034 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1041027068 8:53697762-53697784 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1041301724 8:56418622-56418644 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1042725909 8:71876685-71876707 AATTCAGCTGTGAATCTGTCTGG + Intronic
1042936170 8:74060713-74060735 ATTTCAGGTAGTAAGCTGAGGGG + Intergenic
1043778367 8:84299571-84299593 AATTCAACTGTGAATCTGTGTGG + Intronic
1043786326 8:84404775-84404797 AATTCAGCTGTGAATCTGTCTGG + Intronic
1043950811 8:86307351-86307373 AATTCAGCTGGGAATTAAAGAGG - Intronic
1044947600 8:97404964-97404986 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1044961323 8:97533710-97533732 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1045212426 8:100112131-100112153 AATTCAGCTGTGAATCTGTCTGG - Intronic
1045212848 8:100116798-100116820 AATTCAGCTGTGAATCTGTTTGG - Intronic
1045813892 8:106257311-106257333 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1045881181 8:107042492-107042514 AATTCTGCTGTGAATCTGACTGG + Intergenic
1045908256 8:107374813-107374835 AATTCTGGTGGAAATCTGGATGG + Intronic
1045975326 8:108124932-108124954 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1046448897 8:114361563-114361585 AATTCAGGTGTGAATCTATCTGG - Intergenic
1046674050 8:117089338-117089360 AATTCAGCTGGGAATATGGTGGG - Intronic
1046702201 8:117414176-117414198 AATTCATATGGAAAGCTGAGAGG + Intergenic
1046840896 8:118855871-118855893 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1046995507 8:120516538-120516560 AATGCAGGCAGGAAACTGAGGGG - Intronic
1049013114 8:139900903-139900925 AAGCCAGATGGGAATCTGTGAGG + Intronic
1049136390 8:140904601-140904623 AATTCAGCTGTGAATCTGTCTGG + Intronic
1051373544 9:16380339-16380361 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1051939901 9:22493041-22493063 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1051963618 9:22799303-22799325 AATTCAGCTTGGAAGCTGTGTGG - Intergenic
1052071079 9:24081823-24081845 AATTCAAGTTGAAATTTGAGTGG - Intergenic
1052078878 9:24178927-24178949 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1052141363 9:24989371-24989393 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1052224965 9:26074727-26074749 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1052893514 9:33725595-33725617 AATTTAGCTGTGAATCTGTGTGG - Intergenic
1053024439 9:34718475-34718497 AGCTCAGGTGGGAATATGAGAGG - Intergenic
1054753873 9:68937214-68937236 AATTCAGCTGTGAATCTGTCTGG + Intronic
1054847356 9:69810956-69810978 AAGGGAGGTGGGAATCTGAAAGG - Intergenic
1055125055 9:72709449-72709471 AATTCAGCTGTGAATCTGTCTGG + Intronic
1055168638 9:73227302-73227324 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1055186870 9:73467592-73467614 AATTCAGCTGTGAATCTGTCCGG + Intergenic
1055343016 9:75305579-75305601 AATTCAGCTATGAATCTGTGTGG + Intergenic
1058597237 9:106628502-106628524 AAAGAGGGTGGGAATCTGAGAGG + Intergenic
1058616368 9:106832769-106832791 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1058925819 9:109662772-109662794 AATTCAGCTGTGAATCTGTCTGG + Intronic
1059216700 9:112571205-112571227 AATTCAGGTGTCAATTTGACTGG - Intronic
1059524212 9:114975124-114975146 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1059692614 9:116699873-116699895 AATTTAGGTGGGAAGCGGGGAGG - Exonic
1059780230 9:117518330-117518352 AATTCAGGATGAAATTTGAGTGG - Intergenic
1061789340 9:133050805-133050827 ATCTCAGGTGAGAATCTGATTGG + Exonic
1062299752 9:135859052-135859074 ATTTCAGGTGTGAATTTGACTGG - Intronic
1186079890 X:5919587-5919609 AGCTCAGGTGGTAATGTGAGTGG - Intronic
1186303106 X:8222069-8222091 AATGGAGGTGGGAATCAGTGAGG + Intergenic
1186332965 X:8555731-8555753 AATTCAGCTGTGAATCTGTCTGG - Intronic
1186702833 X:12109957-12109979 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1186879011 X:13846131-13846153 CACTCAGGTGGGAAACTCAGAGG - Intronic
1187108965 X:16275883-16275905 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1187286562 X:17910383-17910405 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1188109806 X:26183736-26183758 AATTCAGCTGAGAATCTGTCTGG - Intergenic
1188119208 X:26283904-26283926 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1188644663 X:32551024-32551046 TATTCAGGTGTGAATCTGTCTGG - Intronic
1188711588 X:33406929-33406951 AATTCAGCTGTGAATCTGTGTGG + Intergenic
1188851251 X:35135129-35135151 AATTCAGGTGTGAATCTGTCTGG + Intergenic
1189573737 X:42327285-42327307 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1189855319 X:45218249-45218271 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1190604097 X:52122686-52122708 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1191037329 X:56040856-56040878 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1191629419 X:63305532-63305554 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1191642320 X:63440201-63440223 AATTCAGCTGTGAATCTGTATGG - Intergenic
1191732016 X:64346682-64346704 TGTTCAGGTGGCAAACTGAGAGG + Intronic
1191770585 X:64753621-64753643 AATTCGGCTGTGAATCTGTGTGG - Intergenic
1191944971 X:66523550-66523572 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1192164243 X:68816103-68816125 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1192277179 X:69645204-69645226 AATTCAGCTGTGAACCTGTGTGG + Intronic
1192406782 X:70894110-70894132 AATTCAGCTGTGAATCTGTCTGG - Intronic
1192677463 X:73213627-73213649 AATTCTAGTGTGAAACTGAGGGG + Exonic
1192702871 X:73494649-73494671 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1192771469 X:74195917-74195939 AATTCAAGTTGGAATTGGAGGGG + Intergenic
1192865429 X:75126945-75126967 AATTCAGCTGTGAATCTGTCTGG - Intronic
1192922453 X:75721224-75721246 AATTCAGCTGGGAATCCGTCTGG + Intergenic
1193007694 X:76639184-76639206 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1193039612 X:76990865-76990887 AATTCAGATGTGAATCTGTCTGG - Intergenic
1193279134 X:79626612-79626634 AATTCAAGTTGAAATTTGAGTGG + Intergenic
1193351143 X:80466096-80466118 AACTCAGCTGTGAATCTGTGTGG - Intergenic
1193477547 X:81985129-81985151 AATTCAGTTGTGAATCTGTCAGG - Intergenic
1193517588 X:82488403-82488425 AATTCAGCTGTGAATCTGCCTGG - Intergenic
1193589402 X:83369186-83369208 AATTCAGCTGTGAATCTGCCTGG - Intergenic
1193598802 X:83482619-83482641 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1193605594 X:83564331-83564353 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1193625687 X:83817841-83817863 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1193789910 X:85805013-85805035 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1194165600 X:90511217-90511239 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1194232294 X:91339478-91339500 AATTCAGCTGTGAATCACAGTGG - Intergenic
1194238244 X:91411358-91411380 AATTCAGCTGTGAATCCGTGTGG - Intergenic
1194395651 X:93382025-93382047 AATTCAGCTGTGAATCTGTCGGG - Intergenic
1194441383 X:93938804-93938826 TATTCAGCTATGAATCTGAGTGG - Intergenic
1194515019 X:94841813-94841835 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1194549426 X:95277601-95277623 AATTCAGCTGTGAATCTGTCAGG - Intergenic
1194608302 X:96008592-96008614 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1194761451 X:97800521-97800543 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1195225986 X:102794016-102794038 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1195237381 X:102914694-102914716 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1195248466 X:103018804-103018826 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1195855261 X:109324849-109324871 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1195984881 X:110618640-110618662 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1196468515 X:115997237-115997259 AATTCAGCTGTGAATCTGTTTGG + Intergenic
1196575164 X:117308568-117308590 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1196899379 X:120368039-120368061 AATGCAAGTGTGAATCTGGGAGG + Intronic
1196927734 X:120650159-120650181 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1197086649 X:122484516-122484538 AACTCAGGTGGGAGTGTGTGGGG + Intergenic
1197094572 X:122577871-122577893 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1197158816 X:123300330-123300352 AATTCAGCTGTGAATCTGTCTGG + Intronic
1197177214 X:123499019-123499041 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1197545542 X:127819426-127819448 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1197575166 X:128202462-128202484 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1197575958 X:128211768-128211790 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1197594132 X:128446395-128446417 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1198044145 X:132883232-132883254 AATTCAGCTGTGAATCTGTCTGG + Intronic
1198604222 X:138319031-138319053 AATTCAGCTGTGAATCTGTCTGG + Intergenic
1198710730 X:139500170-139500192 AATCCAGGTGGGAATTTGAAAGG - Intergenic
1199113576 X:143962503-143962525 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1199564512 X:149200025-149200047 AATTCAGCTGTGAATCTGCCTGG + Intergenic
1200511866 Y:4089035-4089057 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1201259815 Y:12148012-12148034 AATCCTGGTGGGACTCTGGGTGG + Intergenic
1201352798 Y:13064405-13064427 AATTCAGGTGTGAATTTGTCTGG - Intergenic
1201466373 Y:14285679-14285701 AATTCAGCTGTGAATCTGTGTGG - Intergenic
1201497950 Y:14609817-14609839 AATTCAGCTGTGAATCTGTCTGG + Intronic
1201498501 Y:14616051-14616073 AATTCAGCTGTGAATCTGTCTGG + Intronic
1201913878 Y:19161530-19161552 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1202065273 Y:20932895-20932917 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1202079210 Y:21067138-21067160 AATTCGGCTGTGAATCTGACTGG - Intergenic
1202098501 Y:21280435-21280457 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1202335317 Y:23802730-23802752 AATTCAGCTGTGAATCTGTCTGG - Intergenic
1202535450 Y:25867329-25867351 AATTCAGCTGTGAATCTGTCTGG + Intergenic