ID: 1173260462

View in Genome Browser
Species Human (GRCh38)
Location 20:41430454-41430476
Sequence TCATATGAGCTACTGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173260456_1173260462 14 Left 1173260456 20:41430417-41430439 CCAGTTTAATGTCAGTGGCTTTC 0: 1
1: 0
2: 2
3: 13
4: 155
Right 1173260462 20:41430454-41430476 TCATATGAGCTACTGCTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173260462 Original CRISPR TCATATGAGCTACTGCTGGG AGG Intronic
902653805 1:17853887-17853909 CCACAAGAGCTTCTGCTGGGTGG + Intergenic
908945897 1:69496534-69496556 TAAAATGTGCTACAGCTGGGAGG + Intergenic
918191657 1:182181379-182181401 TCAGCTCAGCCACTGCTGGGTGG - Intergenic
924082723 1:240416114-240416136 CCAGATGAGATACTGATGGGAGG - Intronic
1063969155 10:11369348-11369370 TTATATGAGCTTCTGCATGGGGG + Intergenic
1065701359 10:28428921-28428943 TCTTCTGAGCTAGTGCTGGCTGG + Intergenic
1071267609 10:83978176-83978198 TCATATGAGCTTCTGCTTCTAGG - Intergenic
1075853066 10:125604201-125604223 TCATCTGGGCTCCTGCTGTGTGG - Intronic
1078130866 11:8613040-8613062 GTTTATGAGCTCCTGCTGGGAGG - Exonic
1090814442 11:130279683-130279705 TCAAATGAGCTACGGTTGGTTGG - Intronic
1097841290 12:64324028-64324050 ACTTATGAGCTTCTGCGGGGAGG - Intronic
1100120728 12:91366664-91366686 TCATCTCAGCAACTGATGGGGGG - Intergenic
1103618678 12:122172263-122172285 TCATATGGGCTAGTCCCGGGAGG - Exonic
1106553933 13:30794105-30794127 TTATTTGTGCTACTGCTGGTGGG + Intergenic
1112863012 13:103857667-103857689 TTGTATTAGCTACTACTGGGTGG + Intergenic
1113258288 13:108531537-108531559 TGATATGAGCAGCTGATGGGTGG + Intergenic
1113389715 13:109883815-109883837 TGATCTGAGCTACTGATGCGAGG - Intergenic
1114798011 14:25739247-25739269 TCATGTGAGGAACTGGTGGGAGG - Intergenic
1117972066 14:61261496-61261518 TCATATGTTCTCCAGCTGGGTGG - Intronic
1120174531 14:81278757-81278779 ACATATGAGCTACTGTTCAGGGG + Intronic
1121224133 14:92308845-92308867 ACAGCTGAGCTTCTGCTGGGTGG - Intergenic
1126795483 15:52257567-52257589 CCAGATGAGCTCCTGCTGGAAGG + Intronic
1128059758 15:64727883-64727905 TGATATCAGTGACTGCTGGGTGG + Intergenic
1130924361 15:88374202-88374224 TCATGTGAGCTGCATCTGGGAGG + Intergenic
1131569467 15:93520092-93520114 TGATATTGGCTACTTCTGGGAGG + Intergenic
1131629702 15:94163518-94163540 TTATGAGAGCTACTGCTGAGAGG - Intergenic
1134627816 16:15735362-15735384 TCACCTGAGCTCCTGCTGAGTGG + Exonic
1138729354 16:59177739-59177761 TCATATGAGCCACATCTGTGTGG - Intergenic
1139299735 16:65934671-65934693 TAAGATGAGCTCCTGCTAGGTGG - Intergenic
1141241246 16:82266984-82267006 ACATTTAAGCAACTGCTGGGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1151397391 17:73832706-73832728 TCATCTGCACAACTGCTGGGTGG - Intergenic
1152803272 17:82342007-82342029 TCATCTGATCAACGGCTGGGTGG - Intergenic
1155755198 18:29485315-29485337 TCATATAAGCTTCTGGTGTGTGG + Intergenic
1157281419 18:46348534-46348556 TACCATGGGCTACTGCTGGGAGG + Intronic
1157930470 18:51816090-51816112 TCATATGTGCTCCATCTGGGAGG + Intergenic
1159177018 18:64850558-64850580 TCAAATGAGCTTGTGCTGAGTGG + Intergenic
1163186991 19:15645775-15645797 TGATATGTGCTGCTGGTGGGTGG + Exonic
1164798825 19:31058805-31058827 ACATGTGAGCAACTTCTGGGTGG - Intergenic
1165716071 19:38046618-38046640 TCATGTGGGCTCTTGCTGGGGGG - Intronic
1165722738 19:38091047-38091069 ACATATGGGCAACTGCTGGGTGG + Intronic
1166265296 19:41678507-41678529 TAATATTAGCTACTGTTGAGGGG + Intronic
930143930 2:47981865-47981887 TCACCTGAGCTACAGCCGGGTGG - Intergenic
930837559 2:55810588-55810610 TCATATGAGATATTGCTGCAAGG - Intergenic
933260003 2:80121938-80121960 TCACATGAAGTACTGTTGGGTGG + Intronic
933544574 2:83694567-83694589 TCAGATGGAGTACTGCTGGGTGG + Intergenic
933830964 2:86208191-86208213 TTATATGAGCTTCTGCTGACTGG - Intronic
936466387 2:112755161-112755183 ACATATGTGCTTCTCCTGGGAGG + Intronic
939168829 2:138670313-138670335 TCATCTGAGCTACAGTTGCGTGG - Intergenic
940035267 2:149306165-149306187 TCATATGGGCTACTCCGGTGGGG + Intergenic
940409767 2:153347746-153347768 TCATATGGTCTAATGCTGGGTGG + Intergenic
942908273 2:181208978-181209000 TCATGTGATGTAATGCTGGGGGG - Intergenic
944304614 2:198165229-198165251 TCAGATGAGGTACAGGTGGGAGG + Intronic
944581830 2:201138323-201138345 TCCCATGAGCAGCTGCTGGGCGG - Intronic
949007912 2:241660630-241660652 TCATATGAGTTATTTCTGAGTGG - Intronic
1170003990 20:11646456-11646478 TCATGTCAGCCACTGCAGGGAGG + Intergenic
1170088883 20:12568000-12568022 TCAAATGATCTACTACTGGTAGG - Intergenic
1170872691 20:20221364-20221386 TCATATGAGCTACTTGTTTGGGG + Intronic
1173260462 20:41430454-41430476 TCATATGAGCTACTGCTGGGAGG + Intronic
1175342913 20:58246151-58246173 TCAGAGGAGCTACTGCTGTGTGG + Intergenic
1179927767 21:44547418-44547440 AAATATGAGCTACTCATGGGGGG - Intronic
949323788 3:2841209-2841231 TCAAAAGAGTTACAGCTGGGTGG + Intronic
951656144 3:25010740-25010762 TCATAGGAGTTAGTGCTGGAAGG - Intergenic
953857811 3:46514631-46514653 TCTTATGACCGACTGCAGGGAGG - Intergenic
956941356 3:74165326-74165348 TTATATCAACTTCTGCTGGGAGG - Intergenic
958414183 3:93854496-93854518 TCAACTGAGCCACAGCTGGGTGG + Intergenic
960129020 3:114033532-114033554 TAATATGTTCTACTTCTGGGTGG - Intronic
960258291 3:115534142-115534164 TTGTATAAGCTACTGCAGGGAGG - Intergenic
961964739 3:130890636-130890658 TCATATGAGCTACTTGTGTTTGG - Intronic
965403027 3:168236205-168236227 CCATATTAGTTACTGCTGGGAGG + Intergenic
967404872 3:189104151-189104173 TCCTAAGTGCTACTGTTGGGGGG - Intronic
971814231 4:31466206-31466228 TCATTTGTGCTATTGCTGTGGGG + Intergenic
973129236 4:46629513-46629535 TCAAATGAGATACTCTTGGGAGG - Intergenic
979775406 4:124583245-124583267 CCATTTGAGCTACTTGTGGGAGG + Intergenic
985429772 4:189867984-189868006 TCTTATGATCTGCTCCTGGGGGG + Intergenic
986179917 5:5384041-5384063 TCACATGCGCTTCTGCGGGGAGG - Intergenic
986284635 5:6350419-6350441 TAATATCAGCAACTGCTGGGAGG + Intergenic
997298530 5:132785149-132785171 TGATATGAGCTGGAGCTGGGTGG - Intronic
1006137482 6:31904129-31904151 TCAGATGAGCTAAGGATGGGCGG - Intronic
1007152534 6:39708247-39708269 GCACATGAGCTCTTGCTGGGTGG - Intronic
1011910842 6:92435378-92435400 ACATATGAGGCACTCCTGGGTGG - Intergenic
1012046939 6:94288405-94288427 GCATATGAGCTGGTGGTGGGAGG + Intergenic
1013527005 6:110983632-110983654 TAAAATGAGCTAGGGCTGGGAGG - Intronic
1020390424 7:7651739-7651761 TCATATGTGACTCTGCTGGGTGG + Intronic
1020617130 7:10473520-10473542 TCATTTGAGCTATTTGTGGGAGG - Intergenic
1035983611 8:4401525-4401547 ACAGGGGAGCTACTGCTGGGAGG - Intronic
1039181208 8:34868702-34868724 ACCTAGGAGCTCCTGCTGGGTGG - Intergenic
1039764320 8:40612262-40612284 TCATATCTGCTACTGCTCTGGGG + Intronic
1042749511 8:72142796-72142818 TCAAATGAGATTCTGATGGGAGG + Intergenic
1043377855 8:79670050-79670072 TGATGTGTGCTACTTCTGGGTGG - Intergenic
1048570708 8:135653039-135653061 TCATTTGAACTGCTGCTGGCGGG + Intronic
1056071388 9:82990951-82990973 TCATATGCACTATGGCTGGGAGG - Intronic
1192822844 X:74662579-74662601 TCTTATGAGTTAAAGCTGGGTGG + Intergenic
1193903649 X:87216311-87216333 TCATATGAGGTAGTTTTGGGTGG + Intergenic
1194286745 X:92020228-92020250 TCATTTGAGCTCCTTGTGGGAGG + Intronic
1195728484 X:107941196-107941218 TAATATGAGCTGAGGCTGGGTGG + Intergenic
1196882252 X:120208955-120208977 TCATAAAAGCTGCTGCTGGCCGG + Intergenic
1198282518 X:135155862-135155884 TCATAGGAGCTACTGCTGCATGG + Intergenic
1198284806 X:135178840-135178862 TCATAGGAGCTACTGCTGCATGG + Intergenic
1198288441 X:135216660-135216682 TCATAGGAGCTACTGCTGCATGG - Intergenic
1199614588 X:149647011-149647033 TCATATGAACTACAACAGGGAGG + Intergenic
1200116185 X:153770702-153770724 TCAAAGGGCCTACTGCTGGGCGG - Intronic
1200604290 Y:5244788-5244810 TCATTTGAGCTCCTTGTGGGAGG + Intronic
1201732688 Y:17222065-17222087 TCATATGAGCAACTGAAGGAGGG + Intergenic