ID: 1173261305

View in Genome Browser
Species Human (GRCh38)
Location 20:41438758-41438780
Sequence CAGGGAAAACACTCTCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173261305_1173261308 14 Left 1173261305 20:41438758-41438780 CCATTCAGAGAGTGTTTTCCCTG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1173261308 20:41438795-41438817 CATGAGAATCACCAGTCATATGG 0: 1
1: 0
2: 2
3: 5
4: 88
1173261305_1173261309 15 Left 1173261305 20:41438758-41438780 CCATTCAGAGAGTGTTTTCCCTG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1173261309 20:41438796-41438818 ATGAGAATCACCAGTCATATGGG 0: 1
1: 0
2: 0
3: 17
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173261305 Original CRISPR CAGGGAAAACACTCTCTGAA TGG (reversed) Intronic
901249860 1:7769883-7769905 TAGGGGAAAAGCTCTCTGAATGG - Intergenic
905838261 1:41149853-41149875 AAAGGAAAAAACTATCTGAAAGG - Intronic
908566673 1:65363934-65363956 CATGAAAAACACCTTCTGAAGGG - Intronic
910867281 1:91799963-91799985 CAGGGCAAACACCCTCTTTAAGG + Intronic
913073122 1:115318760-115318782 CAGGGGAAATGCTCTCGGAAGGG - Intronic
917262226 1:173182629-173182651 CAGGGAAAGAACTCACTAAATGG + Intergenic
917513622 1:175688834-175688856 CATGGAAGAAACTCTCTGAGAGG - Intronic
918377763 1:183926274-183926296 CAGCAAAATCACCCTCTGAAGGG + Exonic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919986601 1:202680085-202680107 CAGGATATGCACTCTCTGAAAGG + Intronic
921109862 1:212025112-212025134 CAGGGAAAATTCTTTCTGTATGG + Intronic
922151732 1:223011393-223011415 CAGGGAAGCCACTCACTGAAGGG - Intergenic
924691300 1:246353877-246353899 CAGGGAAAACACACACTGTGTGG - Intronic
1062953318 10:1522111-1522133 CAAGGGAAACATTCTGTGAATGG + Intronic
1063758305 10:9041457-9041479 CTGGGAGAACACTCTCTGCTGGG - Intergenic
1067090145 10:43262293-43262315 CAGGGAGAACTCTCTCTTCAAGG + Intronic
1067698393 10:48551723-48551745 CAGAGAAAACACTCTTATAAGGG - Intronic
1067897948 10:50204984-50205006 TAGGGATAACACTCTCTCTATGG + Intronic
1068811742 10:61263317-61263339 CATGGGAAACACAATCTGAATGG - Intergenic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1071460685 10:85891603-85891625 CAGGGAAAGGACCATCTGAAAGG + Intronic
1071962949 10:90824275-90824297 AAGGGAAAACACTGTCTTGAAGG + Intronic
1074408440 10:113201550-113201572 AAGGGAACACACTCTCTCGAAGG + Intergenic
1075322901 10:121506430-121506452 CAGCCAGAACACTCTCTGCATGG + Intronic
1077648074 11:3944220-3944242 CAGGGGAAACACCCTGTAAAAGG - Intronic
1078818656 11:14853079-14853101 AAGTGCAAACACTCTCAGAAAGG - Intronic
1079937803 11:26639402-26639424 TAGTGAAAACAGGCTCTGAAAGG - Intronic
1080143205 11:28947465-28947487 CAGGGACTGCATTCTCTGAATGG - Intergenic
1080741218 11:35066118-35066140 CAGGGAAAACAATTTAAGAAGGG - Intergenic
1080781285 11:35432206-35432228 CAGGGACAAAACTCAGTGAAGGG - Exonic
1083149158 11:60780775-60780797 CATTGAAATCACTCTCTGTAAGG + Intergenic
1084647840 11:70470456-70470478 CAGGCAAAACACTAGCTCAAAGG - Intronic
1086571045 11:88285001-88285023 CTGGGAAGACACTTGCTGAAAGG + Intergenic
1086671113 11:89548948-89548970 CAGGGAAAAAAGTCTCATAAAGG + Intergenic
1087363504 11:97190620-97190642 GAGGGAAAACTGTTTCTGAATGG + Intergenic
1088855375 11:113745971-113745993 CAGGGAAAACTCTGTCTTAAAGG + Intronic
1089154949 11:116394565-116394587 CAGGGACAAAACGCTCTGTAGGG + Intergenic
1090248792 11:125236706-125236728 CCTGGTAAACACTCCCTGAAAGG - Intronic
1092056252 12:5510548-5510570 CAGAGGAAACCCTCTCTGATGGG - Intronic
1093089794 12:14908445-14908467 CAGGGAAGGAAGTCTCTGAAAGG - Intergenic
1094155666 12:27334514-27334536 AAGGGACAACACTTTCTTAATGG - Intronic
1094772278 12:33677357-33677379 TAGGGAAAACATTTACTGAATGG - Intergenic
1095305494 12:40634136-40634158 CAGGGAAAGCATTCTAGGAATGG - Intergenic
1096115842 12:49054564-49054586 CAGGGAAACCAATCTGTGATAGG + Exonic
1096436473 12:51594449-51594471 CAAGAAAAACATTCTGTGAATGG + Intronic
1098124518 12:67276410-67276432 CAGGGAAAACACACACTTTAGGG + Intronic
1102032554 12:109750966-109750988 CAGGGAAAACAGACTCTCTATGG - Intronic
1102776582 12:115524889-115524911 CAAGGAAAATGCTCTCTGAGGGG + Intergenic
1102810528 12:115820302-115820324 CATGGAAAGCACTCAATGAATGG + Intergenic
1102944529 12:116974288-116974310 CAGGGAAAGAACTACCTGAAAGG + Intronic
1104274355 12:127311262-127311284 TAGGGAAAATGCTCTCTCAATGG - Intergenic
1104868272 12:131974626-131974648 CAAAGAAAAAACACTCTGAAGGG - Intronic
1105673006 13:22641822-22641844 CGTGGAAAAAACTCTATGAAAGG - Intergenic
1108414811 13:50186644-50186666 TAGGGAAAACACTCACTGGCTGG - Intronic
1112594467 13:100795339-100795361 GAGGAAAAACAGACTCTGAATGG - Intergenic
1113748767 13:112764492-112764514 CAGGGAGAACTCTGTCTGGAAGG + Intronic
1114462712 14:22898007-22898029 CAGTGAAAAGAGACTCTGAAAGG - Intergenic
1114610113 14:24034509-24034531 CAGGGAAAACTGACTCTGACTGG - Intergenic
1115363656 14:32532436-32532458 CAGGGAAAACAATATATAAAGGG - Intronic
1115705618 14:35995021-35995043 CAGGAAAAACACTTCTTGAAAGG - Intergenic
1116932737 14:50705683-50705705 CACCGAAAACAGTCTCTGAGGGG + Intergenic
1117619607 14:57571104-57571126 ATGAGAAAACACACTCTGAAAGG - Intronic
1118110476 14:62712683-62712705 CATGGCAAACGCTCTGTGAAGGG - Intronic
1118338236 14:64873097-64873119 TTGGGAAAACACTATCTGATGGG - Intronic
1119162487 14:72464645-72464667 CAGGGAAAACAGTAGATGAATGG - Intronic
1119953498 14:78770366-78770388 CATGGAGAACTCACTCTGAAAGG - Intronic
1120743727 14:88134977-88134999 CAGAGAAAACACTCCCAGATGGG - Intergenic
1121459283 14:94061606-94061628 CAGGGAATTCACTCTGGGAAGGG - Intronic
1122847374 14:104507176-104507198 AAGAGAACACACTCTCTGCAGGG - Intronic
1127795113 15:62431122-62431144 CAGGTAAACATCTCTCTGAAGGG + Intronic
1127841951 15:62839489-62839511 GAGGGAAAGCATTCTCTGTAGGG - Intronic
1129559635 15:76552789-76552811 CAGGTTAAACAGTCTCTCAAAGG - Intronic
1130851957 15:87803528-87803550 CTTGGAAAACACCCACTGAAGGG - Intergenic
1134416927 16:14052123-14052145 CATGCAAAACCCTCTCTAAATGG - Intergenic
1135191814 16:20360623-20360645 AAGGGAGAACACACCCTGAAGGG - Exonic
1137820194 16:51436777-51436799 CAGGGAATACAGTCCCTGCAAGG + Intergenic
1139015964 16:62689271-62689293 CAGTAAAAACACATTCTGAATGG + Intergenic
1141045531 16:80713092-80713114 CAAGGAACGCAGTCTCTGAAGGG - Intronic
1141301003 16:82815494-82815516 CATGGAAAACACTCCCTACATGG + Intronic
1203141161 16_KI270728v1_random:1767712-1767734 CAGTGAAAATTCGCTCTGAAAGG + Intergenic
1142598007 17:1038997-1039019 CCGAGAGGACACTCTCTGAAGGG + Intronic
1147228963 17:39003241-39003263 CCAGTAAAACACTCTTTGAAGGG - Intergenic
1147366978 17:39965585-39965607 CCGGGTAAACTCTCTCTGCAGGG + Intronic
1150621061 17:66807979-66808001 CTGGCAAAACACTCTCTTGAGGG - Exonic
1151134221 17:71929996-71930018 CAGGGAAAAGTCTCTCTGTGTGG - Intergenic
1151655746 17:75495202-75495224 CAGGCAAAAAATTCTCTGCAGGG + Intronic
1151920429 17:77150651-77150673 GAGGGAGAACACTTTCTGACGGG + Intronic
1152533695 17:80937972-80937994 CTGGGAAGAGACTTTCTGAACGG - Intronic
1153862065 18:9221799-9221821 CAGTGATAACAATCTGTGAAGGG + Intronic
1155234230 18:23803512-23803534 GAGTGAAAACCCTCTCTAAATGG - Intronic
1155887442 18:31225274-31225296 CAGTGAAAACTGTCTCTGAGTGG - Intergenic
1155996678 18:32337999-32338021 CTGTGAAAACACCCTCTCAAAGG + Intronic
1157154181 18:45248852-45248874 CAGGGAAAAGCTTCCCTGAAAGG + Intronic
1160389018 18:78516300-78516322 AAGGGAAAACAATATCTGGAAGG - Intergenic
1162471263 19:10872960-10872982 CAGGGAAAACCCAGTGTGAACGG - Intronic
1164493554 19:28736554-28736576 TAGGCAAACCACTATCTGAAAGG - Intergenic
1165740749 19:38203858-38203880 CAGGGAAAACGCACACTTAAGGG + Intronic
1166266550 19:41688122-41688144 CAGGGAATGCACACTCTGTATGG + Exonic
1166739141 19:45103675-45103697 CAGGGAAGTGACTCTCTGCAGGG + Intronic
926569311 2:14512093-14512115 CAGGGAGACCACAGTCTGAAAGG - Intergenic
926769166 2:16352613-16352635 CATGGAAATCACTGACTGAAAGG + Intergenic
926839388 2:17061891-17061913 CAGGGATAAAACCATCTGAAAGG + Intergenic
928427346 2:31190027-31190049 CAGGGAAAACACCCTTGTAAAGG + Intronic
929040233 2:37737360-37737382 TGGGGAAAAAACTATCTGAAAGG + Intronic
931593579 2:63914575-63914597 CAGGCATAATACTCTCTGTATGG + Intronic
931674487 2:64680771-64680793 CAGGTAAAACACTATCTCAAGGG - Intronic
932807923 2:74798739-74798761 CAGGCAACAGAATCTCTGAAGGG - Intergenic
933781645 2:85806732-85806754 CAGAGCACACACTCTCTGGAAGG + Intergenic
935089583 2:99881980-99882002 CAGGAAAAACACGCTGGGAAAGG + Intronic
935387853 2:102519993-102520015 CCTTGAAAACAGTCTCTGAAGGG + Intronic
935810369 2:106791522-106791544 CTGGGAAAACAGTGTTTGAATGG - Intergenic
935868310 2:107416415-107416437 CTGAGAAAACACTTTCTAAAGGG + Intergenic
937373501 2:121319277-121319299 CATGGACAACACTGCCTGAAAGG + Intergenic
939714834 2:145570947-145570969 AAGGAAACACACTCTCAGAAGGG - Intergenic
941743540 2:169062233-169062255 CAGAGAAAACAGACTCAGAAGGG - Intergenic
942231924 2:173868305-173868327 CAGGTAATTCACACTCTGAATGG + Intergenic
942867024 2:180689049-180689071 AAGGGGAAACACACTCTGAAAGG - Intergenic
945923227 2:215777722-215777744 CAGGGAGAACACAGTGTGAAGGG - Intergenic
947064632 2:226208754-226208776 CAGGGGAAAATCTCTCTGATAGG + Intergenic
1170790239 20:19502357-19502379 CAGGGAAAACAACAGCTGAAAGG + Intronic
1171342046 20:24437441-24437463 CCTTGAAAACACTCTTTGAACGG - Intergenic
1173261305 20:41438758-41438780 CAGGGAAAACACTCTCTGAATGG - Intronic
1173952140 20:47001704-47001726 CAGGTAAAACACACTTAGAATGG + Intronic
1177365665 21:20132483-20132505 GAAGGAAAACACACTGTGAAAGG - Intergenic
1177459443 21:21391420-21391442 AAGAGAAAAAACTCTTTGAAAGG + Intronic
1178365611 21:31986740-31986762 CAGGGAAAACACTCTGGAAGAGG - Intronic
1178968795 21:37152217-37152239 GTGGGAATACAATCTCTGAAAGG - Intronic
1179242999 21:39608656-39608678 GAAGGAATTCACTCTCTGAATGG - Intronic
1181685138 22:24522997-24523019 CCAGGAAAACACTTCCTGAAAGG + Intronic
1183298289 22:37044943-37044965 CAGGAAACACTCTCTCTGATCGG + Intergenic
1183926154 22:41207686-41207708 GAGGGAAGACACTGTCTCAAAGG - Intronic
1184075880 22:42177481-42177503 TGGGGAAAACACCCACTGAAGGG + Intronic
1184628865 22:45759931-45759953 CATGGAAAAAACTTTCTGAGGGG - Intronic
1184887782 22:47356898-47356920 CAGGGAAAACACTTAGGGAAAGG + Intergenic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
955548082 3:60053123-60053145 GAGGGAAAACACATTCTAAATGG - Intronic
959000848 3:100962583-100962605 CAAACAAAACACTCTCTGTAAGG + Intronic
959653722 3:108777653-108777675 GAGTGAAAACAGTCTCTGAATGG + Intergenic
960088331 3:113614108-113614130 CAGGGAAAAGTCACTCTGAAAGG + Intronic
960948421 3:122982736-122982758 CATGGAAACCACACACTGAATGG + Intronic
965779375 3:172268078-172268100 TAGGCAAAACACCCACTGAAGGG - Intronic
966214718 3:177490575-177490597 GAGGCAAAACACTCTCTGTTTGG + Intergenic
966515917 3:180820917-180820939 CAGGGAAAGCACAGCCTGAATGG - Intronic
966667422 3:182487658-182487680 CAAGTAAAATACTCTCTGATTGG - Intergenic
967478014 3:189943189-189943211 CAGAGACAGCACTATCTGAACGG + Intergenic
968223780 3:196959327-196959349 CATTGAAAATACTCACTGAATGG - Intronic
969332057 4:6479664-6479686 CTGGGATAACACACTCTAAAAGG - Intronic
971672340 4:29578803-29578825 AAAGGGAAACACTGTCTGAATGG - Intergenic
971708502 4:30080130-30080152 CAGAGAACACATTATCTGAAAGG + Intergenic
972716652 4:41653201-41653223 TTGGGATAACACACTCTGAATGG - Intronic
972753629 4:42020573-42020595 CAGGTAACACACTCTAAGAAAGG - Intronic
974946865 4:68538973-68538995 CCAGGAAAACACTCTCTAAGAGG - Intronic
976110296 4:81665876-81665898 CAGGGCAGACTCTTTCTGAAAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977460272 4:97316682-97316704 CAGGGAAAATACTGTCTTCAAGG + Intronic
977731852 4:100363244-100363266 CAGGGAAAGCCCACTCTGGAAGG - Intergenic
978846954 4:113285162-113285184 GAGGAAAAACACTGTTTGAAAGG - Intronic
979716334 4:123843267-123843289 CAAGAAAAACACAATCTGAAGGG + Intergenic
979766167 4:124466769-124466791 CACTGAAAGCACTCTCTGAATGG + Intergenic
982919712 4:161257233-161257255 CTGGGAAATCATTCACTGAAAGG - Intergenic
983263185 4:165478811-165478833 TAAGGAAAATACTCTCTGAGAGG - Intronic
983388897 4:167103102-167103124 AAGGGAACCCACTCCCTGAAAGG + Intronic
986830161 5:11568170-11568192 CAGGGAAAGAACCATCTGAAAGG - Intronic
986939380 5:12931805-12931827 CAGGAAAAACACTATCAGAAAGG - Intergenic
987183442 5:15389678-15389700 TAGGGAAAACACTATCTAAAGGG - Intergenic
987677691 5:21095980-21096002 TAGGGAAAACATTCTGTTAATGG - Intergenic
991965783 5:72089126-72089148 CAAAAAAAACACTCTCTGCAGGG + Intergenic
993919775 5:93786962-93786984 TCTGGAAAACCCTCTCTGAAAGG + Intronic
994502603 5:100599078-100599100 CAGGGACAACATTTTCTAAAGGG + Intergenic
995740714 5:115353333-115353355 CAGTGAAAACATTATGTGAAGGG + Intergenic
997677492 5:135724176-135724198 CAGGGAAAACGCTCAATAAATGG - Intergenic
1001729699 5:173942317-173942339 CAGGGAAGACATTTTCTCAAAGG + Intronic
1002142242 5:177149514-177149536 CAGAAAAAACTCTCTCTGCATGG - Intronic
1005336785 6:24804976-24804998 CAGGGAAATCACTCACTGGTAGG - Exonic
1010809563 6:80284930-80284952 CAGAGAAAACATTGTCTGAGTGG - Intronic
1012782723 6:103583312-103583334 CAGGGAAAACACTGTCCTCAGGG - Intergenic
1012991928 6:105935028-105935050 GAGGGAAAACGATCTCGGAAGGG - Intergenic
1013165494 6:107587221-107587243 CAGTGAAAACAGTTTTTGAAAGG + Intronic
1014599446 6:123391258-123391280 AAGGGAAAAAACTAGCTGAAGGG - Intronic
1016226402 6:141744563-141744585 CAAGTAAAACACTCTTAGAAAGG - Intergenic
1018080506 6:160255715-160255737 CATGGAAAACACTCAATAAACGG + Intronic
1022165526 7:27756677-27756699 CATGGCAAACACTCCATGAATGG - Intronic
1029915498 7:104205570-104205592 CAGGAAAAAGACTTTCTAAATGG + Intronic
1031614478 7:123864762-123864784 AAGGGAAAACAGTGTCTGAGAGG + Intronic
1031751941 7:125586051-125586073 CAGTGAAGAGACTTTCTGAAGGG - Intergenic
1035021624 7:155804073-155804095 CAGAGCAAACACCCTCTGGATGG - Intronic
1035029943 7:155850251-155850273 CAGGGAGAAATCTCTCTGAGAGG + Intergenic
1036492380 8:9239722-9239744 CAGGGAAAACATTTGCTAAATGG - Intergenic
1037602711 8:20411555-20411577 CAGGGAAATCAGTCTCTGACTGG - Intergenic
1038828813 8:31034173-31034195 GCGGGGAAACACTTTCTGAATGG - Intronic
1041259708 8:56010250-56010272 CAGGAAGAACACCCTCTAAATGG + Exonic
1043557127 8:81444163-81444185 AAAGCAAAACACTCTCTGCAAGG - Intronic
1044951974 8:97443843-97443865 CAGGGACAACCTTCTCTGAAAGG - Intergenic
1044959320 8:97515085-97515107 CAGGGAGAACACTATCTGGCAGG - Intergenic
1045048555 8:98302126-98302148 CAGGGAAAAAAATCTCTGACTGG + Intergenic
1047886025 8:129251026-129251048 CAGGGACATCTCTGTCTGAATGG + Intergenic
1047906875 8:129481837-129481859 ATGGGAAAACACTCTCAGAGAGG - Intergenic
1048010570 8:130452077-130452099 CAGCTAAAACACACCCTGAAGGG + Intergenic
1049458933 8:142712176-142712198 AAAGGAAAATTCTCTCTGAAGGG + Intergenic
1051065212 9:13094133-13094155 GAGTGAAAACACTCTCTGTAAGG + Intergenic
1051181780 9:14419198-14419220 GAGGGAAAAAAATCTTTGAAAGG - Intergenic
1051833498 9:21308485-21308507 CAGGAAAAAAACCCTCTGGAAGG + Intergenic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1055734121 9:79309635-79309657 CAGGCCAAACACTATGTGAAAGG + Intergenic
1056429777 9:86515648-86515670 CATGGAAAACAGTTTCAGAACGG + Intergenic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1058807860 9:108609711-108609733 CAAGAAAAAAACTCTCTGTAGGG - Intergenic
1059124746 9:111673873-111673895 TAAGGAAGACACTCTCTTAAGGG + Intergenic
1059650077 9:116307931-116307953 CAGAGAAAACACTCTGTGCTGGG + Intronic
1061357916 9:130120309-130120331 CAGGCAAGACACCCTCTGAAGGG - Intronic
1185552882 X:998042-998064 CAGTGAAAATTCGCTCTGAAAGG - Intergenic
1186688193 X:11947625-11947647 CAGGGCAAACCCTGTTTGAAAGG + Intergenic
1186966345 X:14790266-14790288 CTTGTAAAACACCCTCTGAAAGG + Intergenic
1190057996 X:47193274-47193296 CAGGGAAAACACACTCTCCCAGG - Intronic
1190427225 X:50345129-50345151 GAGGGAAAACAATCACTGAAGGG - Intronic
1192178113 X:68898578-68898600 CAGGGAAAAATCTCACTAAATGG - Intergenic
1192209366 X:69117857-69117879 CCTGGAAGACAGTCTCTGAAGGG - Intergenic
1192226899 X:69235175-69235197 AAGTGGAAACACTCTCAGAAAGG + Intergenic
1195008450 X:100710955-100710977 CAGGGAAAGAACTACCTGAAAGG + Intronic
1196939193 X:120759246-120759268 CAGGGCAATCACTCTGTGAATGG - Intergenic
1197108869 X:122748379-122748401 CAGGGAAAGCTTTCTATGAAGGG + Intergenic
1198715182 X:139551111-139551133 CAGGAAAAACAGTCTCAGCACGG - Exonic