ID: 1173262583

View in Genome Browser
Species Human (GRCh38)
Location 20:41450148-41450170
Sequence TTAATGATTTTGTAGTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 1, 2: 4, 3: 47, 4: 505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173262583_1173262586 -8 Left 1173262583 20:41450148-41450170 CCCAACAACTACAAAATCATTAA 0: 1
1: 1
2: 4
3: 47
4: 505
Right 1173262586 20:41450163-41450185 ATCATTAAGAAGATGTTATAGGG 0: 1
1: 0
2: 3
3: 19
4: 286
1173262583_1173262588 -1 Left 1173262583 20:41450148-41450170 CCCAACAACTACAAAATCATTAA 0: 1
1: 1
2: 4
3: 47
4: 505
Right 1173262588 20:41450170-41450192 AGAAGATGTTATAGGGAGACGGG 0: 1
1: 0
2: 3
3: 20
4: 268
1173262583_1173262585 -9 Left 1173262583 20:41450148-41450170 CCCAACAACTACAAAATCATTAA 0: 1
1: 1
2: 4
3: 47
4: 505
Right 1173262585 20:41450162-41450184 AATCATTAAGAAGATGTTATAGG 0: 1
1: 0
2: 2
3: 33
4: 337
1173262583_1173262587 -2 Left 1173262583 20:41450148-41450170 CCCAACAACTACAAAATCATTAA 0: 1
1: 1
2: 4
3: 47
4: 505
Right 1173262587 20:41450169-41450191 AAGAAGATGTTATAGGGAGACGG 0: 1
1: 0
2: 1
3: 23
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173262583 Original CRISPR TTAATGATTTTGTAGTTGTT GGG (reversed) Intronic
900464000 1:2815163-2815185 TTAATAATTTTTTATTTTTTGGG + Intergenic
901257314 1:7841282-7841304 TTAATGATTTTTTTTTTTTTTGG + Intronic
902140157 1:14346805-14346827 TTAATTGTTTTCTAATTGTTTGG - Intergenic
902437486 1:16407936-16407958 TTAAAGTTTTTGTAGATGTGGGG + Intronic
903431740 1:23308632-23308654 TTATTGATATTTTAGTTTTTTGG - Intronic
905161814 1:36042638-36042660 TTAATGATTTTAAATGTGTTGGG + Intronic
906814361 1:48862809-48862831 TTAAGGATTTTTTCTTTGTTTGG - Intronic
908058567 1:60320999-60321021 TTAGTGATTTATTAGATGTTAGG + Intergenic
908284040 1:62574233-62574255 TTAATGATGTTCTATTTATTGGG - Intronic
908625650 1:66038315-66038337 TTAATGATTATGTATGTGTTTGG + Intronic
909559511 1:76994030-76994052 ATAATGACATTGTAGTTGTTTGG - Intronic
909687930 1:78371976-78371998 CTAATGCTTTCGTAGTTGTAGGG + Intronic
910965276 1:92802184-92802206 TTTCTGATTTAGTAGGTGTTAGG + Intergenic
911087715 1:93992997-93993019 AGAAGGATTTTGTATTTGTTTGG + Exonic
911317554 1:96373671-96373693 TTCTTGATTTTGTAGTTTTATGG - Intergenic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
911493858 1:98605446-98605468 TTACTGTTTTTGTACTTATTTGG + Intergenic
912305585 1:108562799-108562821 CCAACAATTTTGTAGTTGTTAGG - Intronic
912879634 1:113397376-113397398 TGAATAATTTTGAACTTGTTTGG + Intronic
912889113 1:113509173-113509195 TAAACGATTTTGTTGTTATTTGG - Intronic
912983258 1:114399584-114399606 TTTATAATTTTATAGTAGTTTGG + Exonic
913452729 1:119003011-119003033 TTGACTTTTTTGTAGTTGTTTGG + Intergenic
914257643 1:145973743-145973765 TAAATTGTTTTGTTGTTGTTTGG - Intronic
914862118 1:151395449-151395471 TTAATGTTTTTGTAGATATAGGG + Intergenic
914952987 1:152133557-152133579 TTAATCTGTTTGGAGTTGTTTGG - Intergenic
914964248 1:152239380-152239402 TTACTTATTTTCTGGTTGTTTGG + Intergenic
915161060 1:153921397-153921419 CTGATGCTTTTGTAGTTTTTAGG - Intronic
915191793 1:154157061-154157083 TTTTTGTTTTTGTTGTTGTTTGG + Intronic
915817237 1:158981080-158981102 GTAATGATTTTGTATTTTTATGG + Intergenic
916029777 1:160865617-160865639 ATATTGATTTTGTAGGTCTTGGG - Intergenic
916030096 1:160869094-160869116 ATAATAATATTCTAGTTGTTGGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916462007 1:165034902-165034924 TTAATGACTTTGACGTTATTAGG + Intergenic
917114098 1:171584574-171584596 TTATTGCTTTTGTTATTGTTTGG + Intronic
917206483 1:172578276-172578298 TTAATGAAATTGTTGTTGATAGG + Exonic
917264837 1:173210053-173210075 TTGAGGGTTTTGTTGTTGTTTGG + Intergenic
917693863 1:177498152-177498174 CTAATGATTTTGTATTTCTGTGG - Intergenic
918178270 1:182064333-182064355 TTGATGATTTTGTTGTTTTTAGG + Intergenic
918616650 1:186551522-186551544 TTAATTATTTTTTAGTTGTTTGG + Intergenic
918656351 1:187030659-187030681 TTAATTTTTTTTTAGTTATTTGG + Intergenic
918737100 1:188078485-188078507 AGAATGATTCTATAGTTGTTCGG - Intergenic
918812972 1:189144065-189144087 TTAAGTATTTTCTGGTTGTTTGG - Intergenic
919216977 1:194569467-194569489 ATATTCATTTTGTATTTGTTAGG - Intergenic
920568253 1:206994026-206994048 TTAATTACTTTGATGTTGTTGGG - Intergenic
921045219 1:211471894-211471916 TTCCTGTTTTTGTTGTTGTTTGG - Intergenic
921553127 1:216563550-216563572 TGAATTATTTTTTATTTGTTTGG - Intronic
922332320 1:224587966-224587988 TTAATTATTTGTTAGTTTTTAGG - Intronic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
923616891 1:235545652-235545674 TTAATGCTTTTGTTGATGTGTGG - Intergenic
923839491 1:237653069-237653091 TCAATTATTTGGTAGTTCTTTGG - Intronic
923961501 1:239089322-239089344 TTATTGTTTTTGTATTTGTAAGG - Intergenic
924332710 1:242956207-242956229 TTAATGAGTCTAGAGTTGTTTGG - Intergenic
1063406067 10:5796415-5796437 TTAATGTTTTTCTAGTTTGTAGG - Intronic
1063470502 10:6280808-6280830 TTTATGTTTCTGTAGTTTTTTGG + Intergenic
1063472592 10:6300114-6300136 TTACTGGTTCTGTGGTTGTTGGG + Intergenic
1064069649 10:12216754-12216776 TTAATTATTCTGTAATTTTTAGG + Intronic
1064258335 10:13764535-13764557 TTAGTGAGTTTGTTGTTGTTAGG - Intronic
1064282347 10:13962607-13962629 TTACTTAATTTGTATTTGTTTGG - Intronic
1064537809 10:16376226-16376248 TAAATAATTTTGTAGATTTTTGG - Intergenic
1067170622 10:43903271-43903293 TTAATCATTCTGTAATTCTTGGG - Intergenic
1069191033 10:65490232-65490254 TTAATGTTTTTGTATTTATAAGG + Intergenic
1069268457 10:66493546-66493568 TTAATTTTTTTGTTGTTGTTGGG + Intronic
1070216469 10:74387397-74387419 CTAATGATTTTCTACCTGTTAGG - Intronic
1070472302 10:76794164-76794186 AAAATTATTTTGTTGTTGTTTGG + Intergenic
1070993735 10:80756305-80756327 TTGATGTTTTTGTTGTTGTTAGG - Intergenic
1071054045 10:81488012-81488034 TTCATGCTTTGGTAATTGTTTGG - Intergenic
1071371395 10:84955234-84955256 TTCATGATTCTGTGGTTCTTTGG + Intergenic
1071923902 10:90383363-90383385 ATAATAATTTTGAAGGTGTTTGG + Intergenic
1072007190 10:91263681-91263703 TTAAAGATTTAGGGGTTGTTCGG + Intronic
1072177213 10:92939143-92939165 GTAAGCATTTTGTAGTTTTTAGG + Intronic
1073039535 10:100593128-100593150 TCAATTTTTTTGTTGTTGTTTGG - Intergenic
1073925693 10:108512575-108512597 TTGTTGTTTTTGTTGTTGTTTGG + Intergenic
1074657723 10:115613697-115613719 TTACTGATTTTATATATGTTTGG + Intronic
1074940863 10:118234992-118235014 TCAATAATTATGGAGTTGTTTGG + Intergenic
1075251382 10:120878158-120878180 GAAATGATTTTGTATGTGTTAGG + Intronic
1075476598 10:122740705-122740727 TTTATGATCTTGTAGTTCTAGGG + Intergenic
1076286025 10:129297098-129297120 TTAATGATGTTGTGGTTATTGGG - Intergenic
1077848230 11:6048739-6048761 TTAGTGATTTTATAGTGGATTGG - Intergenic
1078398954 11:11007170-11007192 TCAATGTTATTGTAATTGTTTGG - Intergenic
1078893138 11:15575540-15575562 GTGATTATTTTGTAATTGTTAGG - Intergenic
1080707462 11:34710370-34710392 TTATTAATTTGATAGTTGTTAGG + Intergenic
1080788775 11:35500497-35500519 TTTATGATTATGTATTTGTGGGG - Intronic
1081233044 11:40609955-40609977 TTAATTATTTTTTAAATGTTTGG - Intronic
1082019567 11:47520644-47520666 TTAATTTTTTTGTATTTTTTGGG - Intronic
1082692759 11:56325698-56325720 GTAATGATTCTGTAAATGTTTGG - Intergenic
1085244239 11:75085878-75085900 TTAATTTTTTTGCAGTTGTTTGG - Intergenic
1085353865 11:75818094-75818116 TTAATAATTTTGGGGTTTTTGGG - Intronic
1085573164 11:77577382-77577404 TTTCTGTTTTTGTTGTTGTTTGG + Intronic
1087317793 11:96624526-96624548 GTAATCATTTTGGAGTTTTTAGG - Intergenic
1087516166 11:99165017-99165039 TCAATTTTTTTTTAGTTGTTGGG + Intronic
1087710899 11:101550188-101550210 ATGATGATTTTGTAATTGTTGGG - Intronic
1087745425 11:101939754-101939776 TTAAAGTATTTGAAGTTGTTTGG - Intronic
1087789216 11:102389699-102389721 TTCATTGTTTTCTAGTTGTTTGG + Intergenic
1088118777 11:106342927-106342949 TTACTGATTTGGAAGTTGTACGG - Intergenic
1088496027 11:110431702-110431724 TGAATGTTTTTGTAGTAATTGGG + Intronic
1090432503 11:126657788-126657810 GTAATGCTTTTGTAGTTCTATGG + Intronic
1090684733 11:129102507-129102529 TTTTTGTTTTTGTTGTTGTTAGG - Intronic
1090708785 11:129366185-129366207 TTAATAATTTTGAGGTTCTTTGG + Intergenic
1091011212 11:132002295-132002317 TTAATAATTATTTAGTTATTTGG + Intronic
1091970995 12:4786894-4786916 TTAAAGTTTGTGTAGTTGTATGG + Intronic
1092829358 12:12428954-12428976 TTAATGGTATTGGAGTTGGTAGG + Intronic
1093216230 12:16364658-16364680 ATAATGGTATTGTAGTTATTTGG - Intronic
1093289839 12:17306321-17306343 ATATTTATTCTGTAGTTGTTAGG + Intergenic
1093716308 12:22386774-22386796 TTAATTCTTCTTTAGTTGTTTGG - Intronic
1094022451 12:25928656-25928678 TTGATGCTTTTCAAGTTGTTAGG - Intergenic
1095212045 12:39505802-39505824 TTTATAACTTTGTAGTTATTTGG + Intergenic
1095494916 12:42773918-42773940 TATATGACTTTGTACTTGTTTGG + Intergenic
1095759740 12:45817013-45817035 TTAATGATATTGCAGTAATTTGG + Intronic
1095765551 12:45890436-45890458 TTAATGATTTAATAGTATTTAGG + Intronic
1096057737 12:48668866-48668888 CTAATGTTTTTGTATTTTTTGGG - Intronic
1096562128 12:52443359-52443381 TTATTGTTGTTGTTGTTGTTAGG - Intergenic
1097526441 12:60741992-60742014 TTAATGATCTGTTTGTTGTTTGG + Intergenic
1097900386 12:64867148-64867170 TTAATGTTGTTGTTGTTGTTTGG - Intronic
1098074986 12:66719625-66719647 TTAATGATGTTTCATTTGTTTGG - Intronic
1098195472 12:67995818-67995840 GAAATGATTTTGCATTTGTTGGG - Intergenic
1098669474 12:73207534-73207556 TTAATGATTTTGTCCTTCTCTGG + Intergenic
1098933821 12:76453695-76453717 TTACTGATTTTTTAATTTTTGGG - Intronic
1100032578 12:90210628-90210650 CTAATGATTTTATAAGTGTTTGG + Intergenic
1100041921 12:90330083-90330105 ATAATGATTTTGGATTTCTTTGG + Intergenic
1100343702 12:93706478-93706500 TTAATGGTTCTGTATTTTTTTGG + Intronic
1100557113 12:95706455-95706477 TTACTGATTTTTAAATTGTTTGG - Intronic
1100880682 12:99013147-99013169 TTAATGACTGTGTTATTGTTAGG - Intronic
1100912965 12:99386656-99386678 TTAATGATTTTGGAAATGCTGGG + Intronic
1101184361 12:102258535-102258557 TTATGTATTCTGTAGTTGTTTGG + Intergenic
1101508122 12:105366521-105366543 TTAATAATTATATAATTGTTTGG + Intronic
1101668268 12:106840610-106840632 AAATTAATTTTGTAGTTGTTTGG + Intronic
1102825889 12:115947616-115947638 TCAGTTATTTTGTAGTTATTTGG - Intergenic
1103104604 12:118212583-118212605 TTAATGTTTATGCAGATGTTAGG + Intronic
1103601231 12:122055910-122055932 TTAAAGATTTTGAAGTTGCCAGG - Intronic
1105412903 13:20186201-20186223 TTTTTGATGTTGTTGTTGTTTGG + Intergenic
1106277503 13:28226602-28226624 AAAATAATTTTGTAATTGTTAGG + Intronic
1106636314 13:31532128-31532150 TTAATAAATTTGTAATTTTTTGG + Intergenic
1107061213 13:36161554-36161576 TTAATGATTTTACAGTATTTGGG + Intergenic
1107139557 13:36983114-36983136 TAAATGATTTTGCTGATGTTAGG - Intronic
1107509761 13:41071876-41071898 CTAATTTTTTTGTAGTTTTTAGG - Intronic
1107677412 13:42811344-42811366 TGAAGGAGTTTGTTGTTGTTTGG + Intergenic
1108103532 13:46983722-46983744 TTAATGATTTTGTAGTATATGGG - Intergenic
1108353933 13:49613096-49613118 TTAATGTTATTGTATTTGATAGG - Intergenic
1108994623 13:56712490-56712512 TTAATGATTCTGTGATTGTTTGG + Intergenic
1110607992 13:77455816-77455838 ATATGTATTTTGTAGTTGTTGGG - Intergenic
1112387919 13:98957427-98957449 ATAATAATTGTGTACTTGTTTGG - Intronic
1112855420 13:103763757-103763779 TAAATGATTTTTTAGAAGTTTGG + Intergenic
1113321097 13:109233155-109233177 TTTTTGTTGTTGTAGTTGTTGGG + Intergenic
1115079042 14:29428461-29428483 TTAAGTATTTTGTAGGTGTCTGG - Intergenic
1115274117 14:31587879-31587901 TTAAAGATTTTATAGTTGCCTGG + Intronic
1115619125 14:35123243-35123265 ATAATGACTTTCTATTTGTTTGG + Exonic
1115737070 14:36344044-36344066 TTAATGACTTTATATTTGTAAGG + Intergenic
1115737151 14:36345265-36345287 TTAAAGATTTTGTAAGTGTTTGG + Intergenic
1115901499 14:38155642-38155664 TTAATTATGTTGTAATTGTAAGG - Intergenic
1115911121 14:38256724-38256746 CTAAAGAATTTGGAGTTGTTTGG + Intergenic
1116243734 14:42380910-42380932 TTAATTTTTTTGTAGATGTTGGG + Intergenic
1116305233 14:43245562-43245584 TTTATTATTTTGTAGCTATTTGG - Intergenic
1116805792 14:49492974-49492996 TTAATTATTTTTTTGTTTTTGGG - Intergenic
1116855398 14:49947897-49947919 TTAATTATTTCTTAATTGTTAGG + Intergenic
1117928775 14:60814896-60814918 TTTATATTTTTGTAGCTGTTTGG + Intronic
1117932886 14:60864369-60864391 TTAAACATTTGGTAGATGTTAGG - Intronic
1117940273 14:60957028-60957050 TTAATGGTGTTGTAGTTATTTGG + Intronic
1118101622 14:62611665-62611687 TTATGTATTTTGTAGGTGTTGGG - Intergenic
1119055981 14:71420041-71420063 TTAAAGCTTTTGTAGTTATAAGG + Intronic
1120372693 14:83657039-83657061 TTGATGATTTTGTCATTGTCTGG - Intergenic
1123482238 15:20642721-20642743 TTAATGTCTTTCTAGTTTTTGGG + Intergenic
1123635298 15:22301512-22301534 TTAAAGATTATGTACTTTTTAGG + Intergenic
1124133642 15:27013059-27013081 TAAAATATTTTGTAGTAGTTAGG + Intronic
1124448420 15:29761478-29761500 TTATAGATTTTGAAGGTGTTTGG + Intronic
1125158323 15:36614758-36614780 TTTTTGTTTTTGTTGTTGTTTGG - Intronic
1125429921 15:39583431-39583453 ATTAAGATTTTGAAGTTGTTTGG + Intronic
1126991464 15:54382271-54382293 TTTTTGTTTATGTAGTTGTTTGG - Intronic
1127494654 15:59498625-59498647 TTCATTATTTAGTAGGTGTTAGG + Intronic
1129008304 15:72393513-72393535 TTATTGATTTTATAGATTTTAGG + Intergenic
1129750836 15:78062333-78062355 TTAGTGACTTTGAAGTTGTTTGG - Intronic
1129921774 15:79325473-79325495 TTAATGATTTTATCCTTTTTTGG - Intronic
1130140051 15:81217792-81217814 TAAATGCTTTTTTAGCTGTTTGG - Intronic
1130385455 15:83407310-83407332 TTTATGTTGTTGTTGTTGTTTGG - Intergenic
1130746423 15:86658761-86658783 TTAATAATTTAGCACTTGTTAGG + Intronic
1131207986 15:90467726-90467748 GTAATTTTTTTGTAGTAGTTGGG + Intronic
1133638220 16:7690672-7690694 TTAATTTTTCTGAAGTTGTTTGG + Intronic
1134514488 16:14875788-14875810 TTAATGATCTTTCTGTTGTTCGG + Intronic
1134593001 16:15472134-15472156 TTAATTCTTTTGAATTTGTTGGG + Intronic
1134702165 16:16274441-16274463 TTAATGATCTTTCTGTTGTTTGG + Intronic
1134969665 16:18520209-18520231 TTAATGATCTTTCTGTTGTTTGG - Intronic
1135201450 16:20440991-20441013 TTAATCATTTCCTTGTTGTTTGG - Exonic
1135217656 16:20586876-20586898 TTAATCATTTCCTTGTTGTTTGG + Intergenic
1135244097 16:20839564-20839586 TTATTGATTCTGTGGTTCTTTGG + Intronic
1137067348 16:35862309-35862331 TTAGTGTTTTTTTAATTGTTTGG - Intergenic
1137749827 16:50852249-50852271 TTTATGAATTTGGAGTTTTTAGG + Intergenic
1137758873 16:50924655-50924677 TTAAGGATTTTGTAGTGGGCCGG - Intergenic
1137938295 16:52656606-52656628 TTTTTGTTTTTGTTGTTGTTGGG - Intergenic
1137949067 16:52764771-52764793 TTAAGGCTGTTGTAGTTGTAAGG - Intergenic
1138721705 16:59089977-59089999 TTCATGATATTTTATTTGTTTGG + Intergenic
1138856799 16:60703568-60703590 TTCATGCTCTTCTAGTTGTTAGG - Intergenic
1138920687 16:61524989-61525011 TTAATAATTTTGAAGTCATTTGG - Intergenic
1139111356 16:63894946-63894968 TCAAAGATGTTGAAGTTGTTAGG + Intergenic
1139363229 16:66416449-66416471 ATCATGATTTTGTTGTTGTTAGG - Intergenic
1140192068 16:72826293-72826315 CTACTGATTTTGTAGTTTTGGGG - Intronic
1140340081 16:74149433-74149455 TTAATGATTTTGTTATTGCTTGG + Intergenic
1141333261 16:83131562-83131584 TTAAAGATTTTTGAGTTCTTGGG + Intronic
1144514276 17:15905265-15905287 TTAGTTGTTTTGTTGTTGTTGGG + Intergenic
1146483595 17:33225496-33225518 TTAATGATTTTGTATTTGTGGGG - Intronic
1147276817 17:39324617-39324639 TAAATGTTTTTATAGTAGTTAGG - Intronic
1147587612 17:41661371-41661393 TTAAACATTTTCTTGTTGTTGGG - Intergenic
1147837086 17:43341205-43341227 TTAATGATTTTTCTGTTGATGGG + Intergenic
1148320874 17:46751488-46751510 TTATTGTTTTTGTAGCTTTTGGG + Exonic
1149862686 17:60132241-60132263 GTAATACTTTTTTAGTTGTTGGG + Intergenic
1149874625 17:60219188-60219210 TTAAGGTTTTTGTTGTTGTTTGG - Intronic
1150088414 17:62296439-62296461 TTAAGGTTTTTGTTGTTGTTTGG - Intergenic
1152374105 17:79909385-79909407 TTAATAATTTTATCTTTGTTGGG - Intergenic
1153363517 18:4225972-4225994 TTAAATATTTTGTAGTCTTTAGG - Intronic
1153729374 18:7993008-7993030 TTAATGTTTTTTTAATTGTGTGG - Intronic
1153928849 18:9860344-9860366 TTTCTGATTTTGTAGTTTTTTGG - Exonic
1154429065 18:14294429-14294451 TTCATGATTTTGGAGCTGTAAGG + Intergenic
1155357940 18:24971622-24971644 TTAATGAATTTGTAGATTTGAGG + Intergenic
1155930964 18:31708221-31708243 TTAATGAATTTGTTGTTGACAGG + Intergenic
1157381306 18:47220817-47220839 TTATTGAATTTGTGGTTGATAGG + Intronic
1157905496 18:51565952-51565974 TTAATAATTTTGTAAATCTTGGG + Intergenic
1158097310 18:53788559-53788581 TTAATGAATTTCTAAATGTTTGG - Intergenic
1158420962 18:57293583-57293605 TAAAAGATTTAGTAGTTGTTGGG - Intergenic
1158644245 18:59230255-59230277 TTTCTGATTTAGTAGGTGTTAGG + Intronic
1158720989 18:59924365-59924387 TTAGTTAATTTGCAGTTGTTTGG - Intergenic
1159268591 18:66118628-66118650 TTAATGATTTTGGAGAAGATTGG - Intergenic
1159494714 18:69187550-69187572 TTTGTCATTTTGAAGTTGTTTGG - Intergenic
1160706660 19:533017-533039 TGGATGTTTTTGTTGTTGTTGGG + Intronic
1161197570 19:2995467-2995489 TTAATTTTTTTGTAGATGCTGGG + Intergenic
1164077188 19:21830446-21830468 ATAATTATTTTGTTGTTGTTGGG - Intronic
1164682551 19:30145319-30145341 TTAATTGTTTTGTTGTTGATGGG + Intergenic
1164736819 19:30547755-30547777 TTAATGATTTTGTACCATTTGGG - Intronic
1164897453 19:31889524-31889546 TTCTTGATTATGTAGTTGTGAGG - Intergenic
1167782667 19:51609907-51609929 TAAGTAATTTTGTTGTTGTTTGG + Intergenic
1167870902 19:52369538-52369560 TTTATGATTATGTATTTATTAGG + Intergenic
925051948 2:822372-822394 TTAATTAATTAGTAGTTGTTTGG + Intergenic
925873464 2:8291665-8291687 TTAATCATTTTCCTGTTGTTAGG - Intergenic
926043844 2:9695172-9695194 TTACTGATTTTTTTGTTGTTTGG + Intergenic
926479602 2:13375840-13375862 TTAAAGATTATGTACTTTTTAGG + Intergenic
926779614 2:16457397-16457419 TTGATGATTTTGTATATTTTAGG + Intergenic
928608924 2:32972555-32972577 TTAATTTTTATGTAGTTGTATGG + Intronic
928686359 2:33754023-33754045 CTAATTTTTTTGTAGTTTTTGGG + Intergenic
929166437 2:38886637-38886659 TTAAGGTTTTTTTAATTGTTGGG - Intronic
929954541 2:46445907-46445929 TTACTGGTTTTCTATTTGTTTGG + Intronic
930261878 2:49156354-49156376 TTATTAATTTTGTACCTGTTAGG + Intergenic
931163284 2:59717574-59717596 TTAATCACTTGGTAGTTGTCTGG + Intergenic
931358526 2:61558160-61558182 TTATTATTTTTGTTGTTGTTTGG + Intergenic
931388926 2:61822895-61822917 TTAATGATTTTGTATTGCCTAGG + Intergenic
931583124 2:63798675-63798697 TTATTTATTTTCTGGTTGTTTGG - Intronic
932140868 2:69276630-69276652 ATAATGAGGTTTTAGTTGTTTGG - Intergenic
932520017 2:72402077-72402099 TTAATTATTTTTTAAATGTTTGG + Intronic
933200009 2:79437533-79437555 TTTATGATTTGATAGTTGTAGGG - Intronic
933320202 2:80764566-80764588 ATAAATATTCTGTAGTTGTTTGG - Intergenic
933845178 2:86320102-86320124 TTACTGATGTTGTAGTGCTTTGG - Intronic
933882950 2:86689259-86689281 ATAATAATTTTGTAATTGCTAGG + Intronic
933917154 2:87007153-87007175 TTGCTGGTTTTGTTGTTGTTGGG + Intronic
934005842 2:87762761-87762783 TTGCTGGTTTTGTTGTTGTTGGG - Intronic
934512438 2:94956406-94956428 TTAATGTCTTTCTAGTTTTTGGG + Intergenic
935390312 2:102544571-102544593 TTATTTCTTTTGTGGTTGTTGGG + Intergenic
935541801 2:104357034-104357056 TTAAAGAAATGGTAGTTGTTTGG - Intergenic
935768795 2:106396861-106396883 TTGCTGGTTTTGTTGTTGTTGGG - Intronic
935911305 2:107899064-107899086 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
935969415 2:108515902-108515924 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
936133082 2:109864105-109864127 TTGCTGGTTTTGTTGTTGTTGGG + Intergenic
936211615 2:110507380-110507402 TTGCTGGTTTTGTTGTTGTTGGG - Intergenic
936277389 2:111112044-111112066 AAAGTGATTTTGTTGTTGTTTGG + Intronic
936420753 2:112361957-112361979 TTGCTGGTTTTGTTGTTGTTGGG - Intergenic
936440772 2:112550835-112550857 TTTCTGATTTTTTTGTTGTTTGG + Intronic
937582852 2:123509837-123509859 TCAATAGTTTTATAGTTGTTTGG - Intergenic
938571801 2:132568284-132568306 TTCATGGTCTTGGAGTTGTTGGG + Intronic
939176121 2:138749167-138749189 CTAATGGTTTTGTAAGTGTTTGG + Intronic
939297042 2:140280331-140280353 TAAAAGATTTTGTTGTTGTGGGG + Intronic
939382550 2:141454557-141454579 TTAATGATGTTTCATTTGTTCGG - Intronic
940097479 2:149993957-149993979 TTAATGTTCTTGTATTGGTTGGG - Intergenic
940305637 2:152223120-152223142 TTAGTGATTTTGCAGTGCTTTGG + Intergenic
940426171 2:153534290-153534312 TTAATAATTTGGTAGGTGTGAGG + Intergenic
941167655 2:162100421-162100443 TTAATGAGATTTTAGTTATTAGG - Intergenic
941546913 2:166862225-166862247 TGAATTAATTTGTAGATGTTTGG - Intergenic
941688907 2:168477909-168477931 TTAATGTTTTTGTCTTTTTTGGG + Intronic
941948872 2:171132229-171132251 GTAATGGTTTTGTAAGTGTTTGG - Intronic
943077590 2:183214842-183214864 TAAATGACTATGTAGTTATTTGG + Intergenic
943281564 2:185940979-185941001 TTAATTGTTTTTTGGTTGTTTGG + Intergenic
943508329 2:188791628-188791650 ATATTTATTTTGTAGTTCTTTGG - Intergenic
944061345 2:195572346-195572368 TTAATGATTTTCTAGGTCTTAGG - Intergenic
944161337 2:196663376-196663398 TTAATAATTTTGGATTTCTTTGG - Intronic
944332148 2:198482692-198482714 TTATCTATTTTATAGTTGTTTGG + Intronic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
945684321 2:212951015-212951037 TTAAAGTTTATGTAGATGTTGGG - Intergenic
946568440 2:220994306-220994328 TTAATCTTTTTAAAGTTGTTTGG + Intergenic
947488326 2:230572588-230572610 TTCTTGTTTTTGTTGTTGTTTGG + Intergenic
948410569 2:237756715-237756737 TTGGTGATCTTGTATTTGTTTGG + Intronic
1169325389 20:4671382-4671404 TTGATTATTTTGTATTGGTTTGG - Intergenic
1171162231 20:22938160-22938182 TTAAGATTTTTGTTGTTGTTGGG + Intergenic
1171961027 20:31494442-31494464 TTTTTGTTTTTGTATTTGTTTGG + Intergenic
1172406304 20:34692353-34692375 TTTATCTTTTTGTTGTTGTTGGG + Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1173977460 20:47197766-47197788 TTAAGTATTTGGTATTTGTTTGG + Intergenic
1174875374 20:54221895-54221917 TTAATAATTTGGCAGTTGTTAGG + Intronic
1176909797 21:14550677-14550699 CTAATTATTTAGAAGTTGTTTGG - Intronic
1177366231 21:20141807-20141829 TTAACAGTTTTGTACTTGTTGGG - Intergenic
1177407665 21:20691413-20691435 TTAGAGATTTTGTATTTGTCAGG - Intergenic
1177715795 21:24838619-24838641 TTAATAATATTGTAGTTTTCGGG + Intergenic
1177776273 21:25570288-25570310 TTAATGATTATGTTTTTGATTGG + Intergenic
1178456759 21:32761855-32761877 TTAATTTTTTTGTAGTTATGGGG - Intronic
1181081641 22:20419511-20419533 TTAGTGAATTTGTGGTGGTTGGG - Intergenic
1181447824 22:22992097-22992119 TAAATGATTTTATAATTCTTTGG + Intergenic
949216100 3:1568997-1569019 TTATTAAGTATGTAGTTGTTTGG + Intergenic
951009514 3:17660122-17660144 TTAGGTATTTTGTAGTTGCTTGG - Intronic
952071082 3:29636608-29636630 TTAATGGGTTTCTAGTTGTTGGG + Intronic
952403290 3:32983093-32983115 TTAAATATTTGGTATTTGTTGGG + Intergenic
952863646 3:37835965-37835987 TTAATAATTTTGTCCTTTTTTGG - Intergenic
953267265 3:41403187-41403209 TTAATTCTTCTGTAATTGTTTGG + Intronic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
954102336 3:48384218-48384240 TCAGTGTTTTTGTAGTTTTTAGG + Intronic
954515531 3:51172676-51172698 TTTATGATTTTTTGGTAGTTTGG + Intronic
955596851 3:60600505-60600527 TTATTGGTTTTATAGGTGTTGGG - Intronic
956010330 3:64823910-64823932 TAATTCATTTTGTAGTTGTCAGG - Intergenic
956457376 3:69435857-69435879 TTCATGATGATGTAGTTGCTGGG - Intronic
957074660 3:75592399-75592421 ATAATGTTTTTGTTGTTCTTAGG + Intergenic
957888046 3:86316367-86316389 TTAAGGCTTTTGGAGTTGTTAGG + Intergenic
957976616 3:87453649-87453671 ATAATGATTTTATATTTCTTTGG + Intergenic
958196117 3:90244506-90244528 CTGATGATTTTGTAAGTGTTTGG + Intergenic
959194431 3:103160715-103160737 TTAATAGTATTATAGTTGTTTGG - Intergenic
959364439 3:105439192-105439214 TTAATGATTCTAAAGTTCTTTGG - Intronic
959516978 3:107279095-107279117 TTATTGTTTTTGTTGTTTTTTGG - Intergenic
959867662 3:111289773-111289795 TTTAGGATTCTGCAGTTGTTGGG + Intergenic
960477645 3:118148766-118148788 TTAAAAATTTTGTTTTTGTTGGG + Intergenic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
961394183 3:126574981-126575003 TTAATGATTTTGTAACTATTAGG + Intronic
962004061 3:131330643-131330665 TTACTGATTTTTCAGTTTTTTGG + Intronic
962489171 3:135874810-135874832 TTGTTGATGTTGTAGTTTTTCGG - Intergenic
963067719 3:141277033-141277055 TTAATGATTTTTCAGGTGTAGGG + Intronic
963194576 3:142512118-142512140 TTATTGTTGTTGTTGTTGTTTGG - Intronic
963330320 3:143907257-143907279 TTAGTTTTTTTGTAGTTTTTAGG + Intergenic
963421692 3:145069195-145069217 TTAAATATTTTGTAATTTTTAGG + Intergenic
963557310 3:146808759-146808781 TCAATGAATTTGTAGTTTTTAGG + Intergenic
963945567 3:151142346-151142368 TTAATGAGTTTTAATTTGTTGGG + Intronic
963982439 3:151554406-151554428 TTATTTATTATGAAGTTGTTTGG - Intergenic
964334594 3:155641728-155641750 TTAAAAATTTTTTATTTGTTTGG - Intronic
965855357 3:173081472-173081494 ATTATGATTTTGTATTTGTTTGG - Intronic
965877114 3:173338164-173338186 TTAAATATTTTGTTGTTTTTTGG - Intergenic
966531946 3:180990773-180990795 TTATTTATTTTGTAATTGTTGGG - Intergenic
966602135 3:181786366-181786388 TTAATGACATTGTAGTGGTCTGG + Intergenic
966651377 3:182304664-182304686 TTAATGATTTTATAATATTTTGG - Intergenic
968937904 4:3622964-3622986 TTAGTGATTTTGTAGTTTAGTGG + Intergenic
970813134 4:20119564-20119586 ATTATAATTTTGAAGTTGTTGGG + Intergenic
970822390 4:20232921-20232943 TTAGTGATTTTCTAGGAGTTGGG - Intergenic
971176384 4:24286392-24286414 TTAATGATATCTTAGTTGTAAGG - Intergenic
971567519 4:28164351-28164373 TTAATTGTTTTTTAATTGTTTGG + Intergenic
972152269 4:36107866-36107888 TTAATAATTTTCTAGGTCTTAGG - Intronic
972263770 4:37439086-37439108 GTAATGATTTTCTATTTCTTGGG - Exonic
972339018 4:38134677-38134699 TAAATGACCTTGTAGTTTTTTGG + Intronic
973050716 4:45592798-45592820 TTGTTGTTTTTGTAGTTTTTTGG + Intergenic
973627423 4:52786917-52786939 TTCCTGATTTTTTATTTGTTTGG - Intergenic
973863081 4:55085007-55085029 TTCTTCATTTTGTAATTGTTAGG - Intronic
974404450 4:61447917-61447939 TTGTTGTTTTTGTTGTTGTTTGG - Intronic
974481135 4:62444656-62444678 TTATTGAGTTTGAAGTTTTTGGG + Intergenic
974590945 4:63947819-63947841 TTAATTATATCGTAATTGTTTGG + Intergenic
974741878 4:66017548-66017570 TTAATGATTTTACAGTTATATGG + Intergenic
975606610 4:76161436-76161458 ATAGTAATTTTGTTGTTGTTGGG - Exonic
975797027 4:78017483-78017505 TTTACCATTTTGTTGTTGTTTGG - Intergenic
975860736 4:78673969-78673991 TTAATGATTTTGTATTCCTGGGG - Intergenic
976311346 4:83616182-83616204 TATAAGATTTTGGAGTTGTTGGG - Intergenic
976477383 4:85500462-85500484 TTAATGAGTTGGTACTTATTAGG - Intronic
977284890 4:95091003-95091025 TAAATGTTTGTGTAGTTGATTGG + Intronic
977295366 4:95203420-95203442 TTACTTTTTTTGTTGTTGTTGGG + Intronic
977555999 4:98487960-98487982 TTAATTTTATTGAAGTTGTTTGG + Intronic
978286816 4:107088579-107088601 TTAATGAGTTTTTTGTGGTTGGG + Intronic
979015809 4:115432377-115432399 TTAAAGATTTTGGAGTTGCCTGG - Intergenic
979039912 4:115776220-115776242 TTATTGATTTTCTGATTGTTAGG + Intergenic
979358664 4:119735165-119735187 TTACTGATTTTCTAGCTATTTGG + Intergenic
979813651 4:125071332-125071354 TTAGTGATTTTGTTTTTCTTAGG - Intergenic
980141898 4:128928127-128928149 TTGTTGTTTTTGTTGTTGTTGGG - Intronic
980241707 4:130186003-130186025 TTATTGAATTTGTACTTATTTGG - Intergenic
981283359 4:142986603-142986625 TTAATTATTTTTTAAATGTTTGG + Intergenic
981739048 4:147983935-147983957 TTTTTGATTTTGTTATTGTTTGG + Intronic
981991433 4:150925658-150925680 TTAATGATTTTGTGTTCATTTGG + Intronic
982397990 4:154933790-154933812 TTAATGCTTCTGTAAATGTTTGG + Intergenic
982648740 4:158059177-158059199 TTTATGATTTTGTACTTATCTGG - Intergenic
982977577 4:162085342-162085364 TTAAAGAATTTATATTTGTTGGG - Intronic
987263266 5:16225184-16225206 TTAATTATCTTGTAGTTTTAGGG + Intergenic
987463034 5:18237048-18237070 CTGATGATTTTGTAAGTGTTTGG - Intergenic
987982405 5:25103198-25103220 TTAATCATTTTATATTGGTTTGG + Intergenic
988061899 5:26181578-26181600 TTATTGATTATGCAGTTCTTGGG + Intergenic
988103703 5:26715455-26715477 TTTATGATTTTGTAGCTCATAGG - Intergenic
988315343 5:29619403-29619425 TTAATTATTTTTTAAATGTTTGG - Intergenic
989291401 5:39770415-39770437 TTAATGTTTTTATATTTTTTCGG + Intergenic
990280124 5:54241268-54241290 TTAGGGATTTTTTAGATGTTAGG - Intronic
990412614 5:55555987-55556009 ATAATGAATTTGTATTTTTTTGG - Intergenic
990696659 5:58425735-58425757 TTCATGATTTGGTAGGTGCTTGG - Intergenic
991053471 5:62297126-62297148 TTTATGGTTTTGAAGTTGTAGGG - Intergenic
991411515 5:66350634-66350656 TTTATTATTTTGTAGGTGTTAGG + Intergenic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
991653432 5:68879462-68879484 TTCATGATTTTTTACTTATTTGG - Intergenic
992583014 5:78201311-78201333 TTTATGTTTTTGTATATGTTGGG - Intronic
992637280 5:78736966-78736988 TTATTGTTGTTGTTGTTGTTGGG + Intronic
992678670 5:79131135-79131157 TTGATGAATTTCTAGGTGTTTGG + Exonic
993056958 5:82992183-82992205 TTCATCACTTTGTAGTTGTGTGG + Intergenic
993732058 5:91433901-91433923 CTGATGGTTTTGTAGGTGTTTGG + Intergenic
994228629 5:97285894-97285916 TTAATTTTTTTGTAGTTGTGTGG + Intergenic
996399096 5:123040743-123040765 TTAATGATTTTGTAGGTCTGCGG + Intergenic
996612598 5:125400623-125400645 TGATTGATTTTGATGTTGTTAGG + Intergenic
998450843 5:142233426-142233448 CTGATGATTTTGTAACTGTTTGG + Intergenic
998774714 5:145586329-145586351 TTAATGAATATTGAGTTGTTAGG - Intronic
1000229982 5:159306788-159306810 TTAATAATTTTTAAGTTGCTGGG - Intergenic
1000557892 5:162749717-162749739 TTAATGTTTTTTTAGTAGTTGGG - Intergenic
1000855211 5:166389653-166389675 TAAATGATTTTCAAGTTCTTTGG - Intergenic
1002931061 6:1635478-1635500 GTTATGATTTTCTAGATGTTTGG - Intronic
1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG + Intergenic
1003864719 6:10352452-10352474 TTAAAGTTTTTGTAGTTTTAGGG + Intergenic
1004405589 6:15330262-15330284 TTAATTATTTTCTACTTGTGTGG + Intronic
1004957287 6:20742620-20742642 TTAAGAATTTTCTAGTTTTTAGG + Intronic
1004986073 6:21084458-21084480 TTGATGAATTTTTAGTTTTTAGG + Intronic
1005215617 6:23524370-23524392 TTGATGTTTTTGTTTTTGTTTGG + Intergenic
1006721655 6:36157400-36157422 TTATTGTTTTTATTGTTGTTTGG - Intergenic
1007805093 6:44437431-44437453 TTAATGACTATATAGTTATTTGG + Intronic
1008227506 6:48938394-48938416 GTATTAATTTTATAGTTGTTAGG + Intergenic
1009762619 6:68027390-68027412 TAAATGATTTTGAAGATCTTTGG - Intergenic
1009915991 6:69997268-69997290 CTAATCATTGTCTAGTTGTTTGG - Intronic
1009938885 6:70266770-70266792 TTACTTATTTTGCATTTGTTAGG - Exonic
1010090774 6:71978462-71978484 TCAATAATTTTCTAGGTGTTTGG + Intronic
1011036640 6:82984234-82984256 TTATTAATTTTATAGTTGTATGG + Intronic
1011290953 6:85776637-85776659 TTATTGCTGTTGTTGTTGTTTGG - Intergenic
1012480963 6:99666501-99666523 TGAAAGAATTTGTAATTGTTGGG + Intergenic
1013560513 6:111299507-111299529 CAAATGATTTTCAAGTTGTTTGG - Exonic
1013871920 6:114774198-114774220 TTAATGTTATTGTACTTATTAGG + Intergenic
1013876085 6:114830577-114830599 TTATTGTTTATGTGGTTGTTTGG + Intergenic
1013953475 6:115813409-115813431 TTAATTATTTTGTGCATGTTTGG - Intergenic
1014864985 6:126518153-126518175 TCAACCATTTTGCAGTTGTTTGG - Intergenic
1015610084 6:135007777-135007799 TGAATGAATTTCCAGTTGTTTGG - Intronic
1016281969 6:142428670-142428692 TTAATGCTTTTATAAATGTTTGG - Intronic
1016435145 6:144029267-144029289 TTAATTTTTTTGTGGCTGTTGGG - Intronic
1016468989 6:144355080-144355102 GTAATTTTTTTGTTGTTGTTCGG + Intronic
1016516977 6:144905160-144905182 TTATTGATTTTGTCTTTGTCAGG + Intergenic
1016629254 6:146208615-146208637 TTATGCATTTTGAAGTTGTTAGG + Intronic
1016926650 6:149356823-149356845 TTTAGGATTTTGTTTTTGTTTGG + Intronic
1017411147 6:154169006-154169028 TTAAGACTTTTGGAGTTGTTGGG - Intronic
1018053701 6:160033687-160033709 TTAATGAGTTTACAGTTGATAGG + Intronic
1018087136 6:160312501-160312523 TTAATTGTTTTCTGGTTGTTTGG + Intergenic
1018179503 6:161208861-161208883 TTAATGATTTTTTTCCTGTTAGG - Intronic
1020312934 7:6883102-6883124 ATAATCTTTTTGTTGTTGTTAGG + Intergenic
1020707594 7:11565143-11565165 TTAATGCTGTTTTTGTTGTTAGG - Intronic
1020725049 7:11801720-11801742 TCATTGTTTTTGTTGTTGTTTGG - Intronic
1020808901 7:12827240-12827262 GTAGTGATTTTGTGGTTTTTCGG + Intergenic
1020866084 7:13564571-13564593 TTAGTAATTATGTGGTTGTTTGG - Intergenic
1020974959 7:14993993-14994015 TTGAAGATATTGTTGTTGTTAGG - Intergenic
1021212333 7:17870177-17870199 TCAATGATTTTGTATCTTTTAGG - Intronic
1021239624 7:18184059-18184081 TTTTAGATTTTGTATTTGTTTGG + Intronic
1022420763 7:30221135-30221157 TTAATGTTTTTGTAGATATGGGG - Intergenic
1022635583 7:32131399-32131421 GTAATGATTTATTTGTTGTTTGG + Intronic
1022694721 7:32692925-32692947 CTGATGATTTTGTAAGTGTTTGG + Intergenic
1022803156 7:33794757-33794779 TTTATGATTTTTTTGTTTTTCGG - Intergenic
1022927905 7:35074425-35074447 CTGATGATTTTGTAAGTGTTTGG + Intergenic
1023022691 7:36024465-36024487 TTAATTATTTTTTATTTGTTTGG + Intergenic
1024086934 7:45901409-45901431 TAAAGGATTTGGTAGTTGTAGGG + Intergenic
1026384513 7:69832809-69832831 TTAATGTTTTTGTTGTTGTTAGG - Intronic
1026494516 7:70890851-70890873 TTATGGATTTTGTGTTTGTTTGG - Intergenic
1027113386 7:75458527-75458549 TTTTTGTTTTTGTTGTTGTTTGG - Intronic
1027115670 7:75477883-75477905 TTTTTGATTTTGTTGTTCTTTGG - Intronic
1027285636 7:76643122-76643144 TTTTTGTTTTTGTTGTTGTTTGG - Intergenic
1027396643 7:77762808-77762830 TTAATAATGTTATAGTTTTTTGG + Intronic
1027410509 7:77912615-77912637 TTGATGGTTTTCTAGATGTTAGG + Intronic
1028221209 7:88199238-88199260 GCAATGATTTTGTAGTGGATTGG - Intronic
1028374370 7:90131166-90131188 CTGATGATTTTGTAAGTGTTTGG - Intergenic
1028458896 7:91069611-91069633 TTAATGATTTAATACTTATTAGG - Intronic
1028749308 7:94364675-94364697 TTAATGATCTTACAGTAGTTGGG + Intergenic
1029894544 7:103968797-103968819 TAATTGTTTTTGTTGTTGTTAGG - Intronic
1030799305 7:113829549-113829571 TGAATGAGATTGTAGTTGATTGG - Intergenic
1030810775 7:113969783-113969805 TTAACTATTTTGTATTTATTGGG - Intronic
1030996767 7:116368840-116368862 TTGATGATTTTGTATTTTTCTGG + Intronic
1031115121 7:117658990-117659012 TTCATGATTTTGTCTTTGTTTGG + Intronic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1031302055 7:120072496-120072518 TTATATATTTTGCAGTTGTTGGG - Intergenic
1031326990 7:120413698-120413720 AAAAAGATTTTGTAGTTGATTGG + Intronic
1031379971 7:121073661-121073683 TTCATGATCTGGTACTTGTTTGG + Intronic
1031613997 7:123859428-123859450 TTAATGGTTTAGGAGGTGTTCGG - Intronic
1031692503 7:124807113-124807135 TTAGTGATTTTGGATTTGATAGG - Intergenic
1031872847 7:127106320-127106342 TAAATGATTTTGTTGTTCATAGG - Intronic
1032133711 7:129254536-129254558 TGAATTATTTTGTACTTGATTGG + Intronic
1032462953 7:132125567-132125589 TTTGGGATTTTGGAGTTGTTTGG - Exonic
1032626860 7:133600566-133600588 TGAATGATTTTCTAATTATTTGG - Intronic
1032681330 7:134186932-134186954 TGAATGAGTTTGTAGTTGGGAGG - Intronic
1032760529 7:134936965-134936987 TAAATGAATTTGTAGGTATTTGG - Intronic
1032933217 7:136698023-136698045 TTAATGAGTGTGAATTTGTTAGG - Intergenic
1033190982 7:139279102-139279124 TTCATGTTTTACTAGTTGTTTGG + Intronic
1033737137 7:144233341-144233363 TTAATGACATTGTGATTGTTTGG + Intergenic
1033745920 7:144317605-144317627 TTAATGACATTGTGATTGTTTGG - Intergenic
1033983004 7:147188960-147188982 TTAATCATTTTGGAGTTATTTGG - Intronic
1034905040 7:154936759-154936781 CTAATGAGTGTGGAGTTGTTAGG + Intronic
1035581569 8:743468-743490 TTAATGATTTTGTCTTGATTTGG + Intergenic
1036030962 8:4972424-4972446 TTAATGGTTTTATAAGTGTTTGG + Intronic
1037131567 8:15413097-15413119 TTAAGGCTTTTGAAGATGTTGGG - Intergenic
1037190227 8:16115632-16115654 ATAATTATTCTTTAGTTGTTTGG + Intronic
1037343831 8:17876981-17877003 TTAATGTTTATTTATTTGTTGGG - Intronic
1038287916 8:26222504-26222526 TTGTTGTTTTTGTTGTTGTTTGG + Intergenic
1039795597 8:40910444-40910466 ATAGTGATTTTTTATTTGTTAGG + Intergenic
1040629042 8:49188059-49188081 TGAATGATTATGTAATGGTTGGG + Intergenic
1041276829 8:56169018-56169040 TTGAAGAATTTGTATTTGTTAGG - Intronic
1042037341 8:64549512-64549534 TAACTCATTTTGTACTTGTTGGG - Intergenic
1042552570 8:70007207-70007229 TTAGTCGTTTAGTAGTTGTTTGG - Intergenic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1044518088 8:93163140-93163162 TAGGTGATTTTGTAGTTGTGCGG - Intronic
1044845757 8:96379441-96379463 TTGATTATTTTGTAGATATTTGG + Intergenic
1045803663 8:106130982-106131004 TCAAGGATTCTGTAGCTGTTGGG + Intergenic
1046165320 8:110426626-110426648 ATAATAATTTTCTAGATGTTAGG + Intergenic
1046710639 8:117507093-117507115 TTAATGACTTTCAAGTTGTCTGG + Intergenic
1046978548 8:120311409-120311431 TAAATGAGTTCGTAGATGTTTGG + Intronic
1047822011 8:128531203-128531225 CTAATGATATTATAGTTGATTGG + Intergenic
1048038449 8:130700644-130700666 TTTATCATTTTGTAGTTCTTTGG - Intergenic
1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG + Intronic
1048780910 8:137999999-138000021 TTATTTCTTTTGTAATTGTTTGG - Intergenic
1048825550 8:138421982-138422004 TTGTTGACTTTGTAGTTGTGTGG - Intronic
1050411223 9:5367768-5367790 TTGATAGTTTTGTTGTTGTTGGG - Intronic
1050653188 9:7795201-7795223 CCAATGATTATGTAGGTGTTAGG - Intergenic
1050886084 9:10767268-10767290 TGAATAATTTTATATTTGTTAGG + Intergenic
1050890024 9:10812926-10812948 TTAAGGAATTTGAAGTTGTGAGG - Intergenic
1051613999 9:18990184-18990206 TGGATTATTTGGTAGTTGTTAGG - Intronic
1052321214 9:27169652-27169674 TTTGTGATGGTGTAGTTGTTAGG + Intronic
1052539147 9:29785332-29785354 TTAATTATTTTTTAAATGTTTGG - Intergenic
1052601883 9:30643689-30643711 TTAAAGCTTTTGTAGTTATATGG - Intergenic
1053115038 9:35492612-35492634 TGAGTTATTTTGTTGTTGTTAGG - Intronic
1054453259 9:65414737-65414759 TTAGTGATTTTGTAGTTTAGTGG - Intergenic
1054794518 9:69287624-69287646 TTTCATATTTTGTAGTTGTTAGG - Intergenic
1055295657 9:74830561-74830583 TTTTTGTTTTTGTTGTTGTTTGG + Intronic
1055483064 9:76728935-76728957 TTAATGGAGTTGTAGCTGTTGGG - Intronic
1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG + Intronic
1056513185 9:87325597-87325619 TGAATAATAGTGTAGTTGTTAGG - Intergenic
1057000153 9:91501290-91501312 TTAATGATTTTGTGGTTAATTGG + Intergenic
1057836049 9:98446284-98446306 ATAATGATGATGTAGTTCTTAGG + Intronic
1058072389 9:100614719-100614741 TTTATGTTTATGTATTTGTTAGG + Intergenic
1058118588 9:101113709-101113731 TTTCTGTTTTTGTTGTTGTTTGG - Intronic
1058335902 9:103828709-103828731 TGAAAGTTTTTGTTGTTGTTGGG + Intergenic
1058392507 9:104511782-104511804 TTAATGATTTTTTTTTTTTTTGG - Intergenic
1058765395 9:108178016-108178038 TTAATAATTTTTAAATTGTTTGG - Intergenic
1185824761 X:3239598-3239620 TGCCTGATTTTGTTGTTGTTGGG + Intergenic
1186578942 X:10796436-10796458 TTAATGATTTTTTTTTTGATAGG + Intronic
1186674016 X:11796958-11796980 TTCATTATTTTGTAATAGTTTGG - Intergenic
1188039835 X:25358886-25358908 TTAATGATTTGGAAGGTGATGGG + Intergenic
1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG + Intergenic
1188518022 X:31008544-31008566 TTAAAGATATTGTAGGAGTTAGG + Intergenic
1188733085 X:33676270-33676292 TTAAAGATTTAGTATTTGCTAGG - Intergenic
1188739601 X:33762134-33762156 TTATTGATATTGTTGTAGTTTGG + Intergenic
1189458410 X:41215588-41215610 TTATTGTTATTGTAGTTCTTTGG + Intronic
1190653822 X:52593624-52593646 TTATTGATTCTGAAGTTGATTGG + Intergenic
1191172764 X:57466352-57466374 TTAATTAGTTTTGAGTTGTTAGG - Intronic
1193405446 X:81095314-81095336 TTTATAATTTTGTAGGTTTTTGG - Intergenic
1193449526 X:81648440-81648462 TTAACGATTTTGTTGTTCATTGG - Intergenic
1193602782 X:83528456-83528478 TTAAGAATTTTATAGATGTTTGG + Intergenic
1193767817 X:85552617-85552639 TTAAGGATTTTGATTTTGTTAGG + Intergenic
1193947824 X:87760640-87760662 TTAATTTTTATGTAGTTGTATGG + Intergenic
1193956666 X:87872154-87872176 TTAATTATTTTTTAGATATTAGG + Intergenic
1195158242 X:102143537-102143559 TTAAAAATTTTCTAGTTCTTTGG - Intergenic
1196408454 X:115391185-115391207 TTCATGATATTGGAGTTGGTAGG + Intergenic
1197547814 X:127848500-127848522 TTAATTATTCTTTAGATGTTTGG - Intergenic
1198054713 X:132982260-132982282 CTACTGATTTTGTGGTTATTGGG + Intergenic
1199122469 X:144072158-144072180 TTAATAATTTTAAAGTTGTGTGG - Intergenic
1199543131 X:148979712-148979734 TGAATTATTTAGTATTTGTTTGG - Intronic
1200120228 X:153786684-153786706 TGCATGATTTAGTAGTTTTTTGG - Intronic
1200293750 X:154896471-154896493 TCAATGATTTGGTAGTGGTTTGG - Intronic
1200715037 Y:6529619-6529641 TAAATGGTTTTGTATATGTTAGG + Intergenic
1201018790 Y:9631512-9631534 TAAATGGTTTTGTATATGTTAGG - Intergenic
1201533962 Y:15024828-15024850 TTAATGCTTTTGTATTTGAATGG + Intergenic
1201693474 Y:16795976-16795998 TTCATTTTTTTGTTGTTGTTTGG + Intergenic
1202016780 Y:20416696-20416718 TTATTGATCTTATAGCTGTTTGG + Intergenic