ID: 1173262706

View in Genome Browser
Species Human (GRCh38)
Location 20:41451073-41451095
Sequence CCCAGTCCCCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 517}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173262706_1173262716 28 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262716 20:41451124-41451146 ATAGGGCAAGTGGATAGCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1173262706_1173262713 10 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262713 20:41451106-41451128 CTGAAACAGAAAGACAGCATAGG 0: 1
1: 0
2: 1
3: 36
4: 437
1173262706_1173262718 30 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262718 20:41451126-41451148 AGGGCAAGTGGATAGCCAAGGGG 0: 1
1: 0
2: 1
3: 15
4: 143
1173262706_1173262714 11 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262714 20:41451107-41451129 TGAAACAGAAAGACAGCATAGGG 0: 1
1: 0
2: 1
3: 40
4: 476
1173262706_1173262715 18 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262715 20:41451114-41451136 GAAAGACAGCATAGGGCAAGTGG 0: 1
1: 0
2: 0
3: 33
4: 353
1173262706_1173262717 29 Left 1173262706 20:41451073-41451095 CCTTCCTCCCTCTGGGGACTGGG 0: 1
1: 0
2: 4
3: 64
4: 517
Right 1173262717 20:41451125-41451147 TAGGGCAAGTGGATAGCCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173262706 Original CRISPR CCCAGTCCCCAGAGGGAGGA AGG (reversed) Exonic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900109201 1:998520-998542 CCCAGTCCCCGGACCGCGGAAGG - Intergenic
900142906 1:1145936-1145958 CCCAGACCCCAGAGGGTGCCAGG - Intergenic
900382992 1:2394434-2394456 CCCAGTGCTCACAGTGAGGATGG + Intronic
900386408 1:2412899-2412921 CGCTGTCCCCAGTGGGAGGGCGG - Intronic
900393301 1:2443185-2443207 CCCAGCCCCAAGAGGGTGGCAGG - Intronic
900592793 1:3467441-3467463 CCCAGTCCTCCCAGGGAGGGTGG + Intronic
900601326 1:3504028-3504050 CTCATTCCCCAGATGGAGGTGGG + Intronic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900933398 1:5750729-5750751 CCCAGTCTCCAGGGGCAGGTGGG - Intergenic
901203083 1:7477685-7477707 CCCAGTCCCCAGAGGCGGGGAGG - Intronic
901672265 1:10862816-10862838 CCCAGCCCCCAGTGGGAGTGGGG + Intergenic
901720068 1:11189964-11189986 ACCAGTCCCCTGAGGGAGCGTGG + Intronic
901946849 1:12711214-12711236 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
902640053 1:17761370-17761392 CTCAGTCCCCGGAGGTAGGAGGG - Intronic
902950939 1:19882481-19882503 TGCAGTCCCCAGCGGCAGGAGGG - Intergenic
903888707 1:26555838-26555860 CCTTGTCCCCAGAGGGAGTAGGG - Intronic
904049900 1:27632820-27632842 CCCACTCCCCTGAGGGACCAGGG - Intronic
904266938 1:29323619-29323641 CCCTGTCCCCAGTTGCAGGAGGG + Exonic
904285360 1:29450216-29450238 CACATGCCCCAGATGGAGGAGGG - Intergenic
904397292 1:30230374-30230396 CCCTGTCCCCACAGGGAGAGGGG - Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904568796 1:31445256-31445278 GCCAGTCCCCAGGGAGTGGAAGG - Intergenic
904632800 1:31855436-31855458 CCCAGTGCCCAGAGCAAGGTGGG - Intergenic
905199728 1:36307505-36307527 CCCTCTCCCCAGATTGAGGACGG + Exonic
905294242 1:36944162-36944184 CCTATTCCCCAAAAGGAGGAGGG + Intronic
905629671 1:39511550-39511572 CCAAGTCCCCACAGCCAGGATGG - Intronic
905668088 1:39774640-39774662 CCAAGTCCCCACAGCCAGGATGG + Intronic
905860799 1:41349887-41349909 CCCCCTCCCCACACGGAGGAGGG + Intergenic
906034133 1:42740342-42740364 CCCAGCCCCCTGGGGGCGGAGGG + Intergenic
906989295 1:50721074-50721096 CCAAGACCCCAGAGGGTGGAGGG + Intronic
907044811 1:51294272-51294294 CCCAGGCCCCTGAGGCATGAAGG + Intronic
907242838 1:53090259-53090281 GCCAGGCCCCAGAGGCAGGCAGG - Intronic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908558581 1:65282574-65282596 ACCTGTCACCAGAAGGAGGAGGG + Intronic
908654798 1:66376745-66376767 CCAAATCCCCACAGGTAGGAAGG - Intergenic
908911554 1:69077793-69077815 CCCATTCCCCAGAGGCTGGTGGG + Intergenic
910588481 1:88903633-88903655 CCCAGACCCCTCAGGGATGAAGG + Intergenic
912272789 1:108227976-108227998 CCCTGTCCTCAGGGGGAGGGAGG - Intronic
912295431 1:108466346-108466368 CCCTGTCCTCAGGGGGAGGGAGG + Intronic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915288535 1:154867984-154868006 TCCAGCCCCAAGACGGAGGAGGG - Intronic
915523770 1:156464029-156464051 CCCATTCTCCAGAGGGAGGGAGG - Exonic
915552071 1:156641192-156641214 TACAGTCCCAGGAGGGAGGAGGG + Intergenic
915588510 1:156858015-156858037 CCCAATCCCTACAGGGAGGAAGG - Intronic
916214545 1:162384138-162384160 CCCTGGCCTCAGCGGGAGGAAGG + Intronic
917312099 1:173689205-173689227 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
917448092 1:175123715-175123737 CCCAGCCCACTGATGGAGGAAGG - Intronic
918215451 1:182389710-182389732 CCTGGTCCACGGAGGGAGGAGGG - Intronic
919583032 1:199400920-199400942 CCCTGTCTCCAAAGGAAGGAAGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
919871621 1:201826230-201826252 CTCAGTCCCCAGAAGGCTGATGG + Exonic
920053735 1:203178457-203178479 TCCAGTCCCGAGAGGCAGGAAGG + Intergenic
920214243 1:204350898-204350920 CCCAGTCCCACGAGGGAGAGAGG + Intronic
922551223 1:226495890-226495912 TCCAGTCCAGACAGGGAGGATGG + Intergenic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
922867443 1:228872253-228872275 CCCATGCCCTAGAGGAAGGAAGG - Intergenic
1063368057 10:5503188-5503210 ACAGGTCCCCAGAGGCAGGAAGG + Intergenic
1065800378 10:29346342-29346364 CCACGTTCCCAGAAGGAGGATGG + Intergenic
1065854774 10:29821211-29821233 CCCAATGCCCACAGGGAGGCAGG + Intergenic
1066471158 10:35699613-35699635 GCCAGTCACCAGAAGCAGGAAGG + Intergenic
1067033796 10:42898465-42898487 CCCAGCCCGCGGAGGGAAGAGGG + Intergenic
1069397139 10:68001723-68001745 ACTAGTTCCTAGAGGGAGGAGGG - Intronic
1069646921 10:70006802-70006824 CCCTGTCCTTAGAGGGAGGCAGG - Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070264263 10:74887053-74887075 CCCTGTCCCCAGAGAGACGGTGG - Intronic
1070626551 10:78054981-78055003 CCCAGACCAGAGAGGCAGGAAGG - Exonic
1070665153 10:78337431-78337453 CCTAGGTCCCAGAGGAAGGATGG - Intergenic
1071134560 10:82438274-82438296 CCCAGCCCACTGAGGAAGGATGG + Intronic
1072608490 10:97001995-97002017 AGCAGTGCCCAGAGGGTGGAGGG + Intronic
1072799769 10:98384908-98384930 CCCAGTCCCCACAGGGTAGTGGG + Intronic
1072994503 10:100231037-100231059 CCCAGTCAAAAGAGGTAGGAAGG + Intergenic
1073181315 10:101585207-101585229 CCCAGGCCCCTGAGAGAGGAGGG - Intronic
1073300920 10:102470577-102470599 CCCAGGCCCCAGGGGAGGGATGG - Intronic
1073336412 10:102713971-102713993 CCCTGTCCCCAGAGTAATGATGG + Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074432066 10:113402772-113402794 CTCAGACGGCAGAGGGAGGAAGG + Intergenic
1074535792 10:114328011-114328033 GCCAGGCCTCAGAGGGACGATGG + Intronic
1075279321 10:121126286-121126308 CGAAGTCCCAAGAGGGAGGAGGG - Intergenic
1075348122 10:121699302-121699324 CCCAGGCCACACTGGGAGGAAGG + Intergenic
1075465117 10:122645255-122645277 CCCAGGCACCCGAGAGAGGATGG + Intergenic
1075962869 10:126584502-126584524 CCCAGTCCCCAGAGTGCAGATGG - Intronic
1076008424 10:126967021-126967043 CCCACCACCCAGAGGGAGGCTGG + Intronic
1076193364 10:128498345-128498367 CCCAGTCCCCAGAGACATGTGGG - Intergenic
1076600310 10:131653162-131653184 CCCACACCCCAGAGGCTGGACGG + Intergenic
1076736409 10:132461112-132461134 CCCAGACTCCAGAGGAAGGAAGG + Intergenic
1077289313 11:1781617-1781639 GCCAGGCCCAAGAGGCAGGAGGG - Intergenic
1077362253 11:2145917-2145939 TCCAGCCCCCGGAGGTAGGAAGG + Intronic
1077552093 11:3205010-3205032 CCCAGGTCCCTGAGGGAGGGTGG + Intergenic
1077699823 11:4431269-4431291 ACCAGTCCCCCGAGGGCTGAGGG + Intergenic
1080445551 11:32334195-32334217 GACAGGCCTCAGAGGGAGGAGGG + Intergenic
1081814892 11:45933433-45933455 CCCAGTGCCCAGAAGAGGGAAGG - Intronic
1081868577 11:46372829-46372851 GCCAGTACCCAGGGGCAGGATGG - Exonic
1081897234 11:46597137-46597159 GCCACTCCCCTGAGGTAGGATGG + Intergenic
1083267273 11:61552413-61552435 GCCAGTGCCCAGTGGGAGAATGG - Intronic
1083302765 11:61747534-61747556 CTCAGACCCCTCAGGGAGGAAGG - Intergenic
1083308365 11:61772299-61772321 CCCCCTCCCTAGAGGGAGGGAGG + Intronic
1083541608 11:63515484-63515506 CTCAGCCCCCAGGGGAAGGATGG - Intronic
1083627209 11:64077901-64077923 CACAGTCCCCAGAGGGTCTAAGG - Intronic
1084164138 11:67367177-67367199 CCCGGCCCCCAGGGGGAGGCGGG + Intronic
1084450299 11:69232868-69232890 CCCAGACCCAGGTGGGAGGATGG + Intergenic
1084768574 11:71327905-71327927 CCAACACCACAGAGGGAGGAGGG - Intergenic
1085197576 11:74681805-74681827 CCCCGTCCCCTGGGGGAAGAGGG + Intergenic
1085297196 11:75437910-75437932 CCCTGTCCCCACCAGGAGGAGGG + Intronic
1085914757 11:80872405-80872427 TCCATTCCACAGAGGGAGGTTGG - Intergenic
1087181945 11:95150366-95150388 CCCAGTCCCGAGAGAGAGAGCGG + Intergenic
1088820115 11:113449360-113449382 CCCAGACCCCTGGGGGAGGAGGG + Intronic
1089498588 11:118919991-118920013 CCCAGAGCACAGTGGGAGGAAGG - Intronic
1089557647 11:119323419-119323441 CCCAGCCACCAGAGGGATGTGGG + Intergenic
1089582011 11:119487208-119487230 CCCAGGACCCACAGTGAGGATGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090073721 11:123565710-123565732 CCCTGCACCCAGTGGGAGGATGG + Intronic
1090182061 11:124708556-124708578 CCAAGCCCACAGAGTGAGGAAGG + Intergenic
1090329499 11:125919985-125920007 CCTAGACCCTAGAGGAAGGAAGG + Intronic
1091540252 12:1454052-1454074 CCCAGCCTCTAGAGAGAGGAGGG + Intronic
1091996541 12:4998192-4998214 CTCAGTCCCCTGAGGAAGGGTGG - Intergenic
1093550747 12:20407548-20407570 CCAAGTTCCCAGAGGGAGGTTGG + Intronic
1094025607 12:25958147-25958169 CCCAGTCCTTGGAGGGGGGATGG + Intergenic
1095593847 12:43937021-43937043 CCAAGTCCCCCAAGAGAGGAGGG + Intronic
1096117166 12:49061250-49061272 CCCAGTCCCCCGTGTGAGGAAGG + Intergenic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1096182344 12:49557752-49557774 CCCCTTCCTCAGAAGGAGGAGGG - Exonic
1096973807 12:55686995-55687017 ACCAGTCCTCAGAGGAAGGTGGG - Intronic
1096980193 12:55724203-55724225 CCCACTCCCCACACTGAGGAGGG + Exonic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1098675857 12:73289121-73289143 CCCTGCCCCCAGAGGCAGGCAGG + Intergenic
1100607499 12:96163568-96163590 CCTAGGACCCACAGGGAGGAAGG + Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG + Intronic
1101919740 12:108922780-108922802 CCCAGTCTCCAGTCGGAAGAAGG - Exonic
1102432439 12:112894134-112894156 CCCAATCCCTAGAGAGAGGCTGG - Intronic
1102519742 12:113470972-113470994 CCCCGTCCCGAGAGAGAGGAAGG - Intronic
1102550937 12:113691782-113691804 CCATGTCCTCACAGGGAGGAAGG - Intergenic
1103040569 12:117691824-117691846 CCCAGTACCCAGTGTGGGGAGGG - Intronic
1103598434 12:122038601-122038623 CCCAGTCCCCAGAGGGAAAGGGG - Intronic
1103905909 12:124327099-124327121 CCGGGTCCCCGCAGGGAGGAAGG + Intronic
1104904762 12:132207297-132207319 CCCAGTGCTCAGAGCGAGGCCGG + Intronic
1104915726 12:132263495-132263517 CCCAGAGCCCAGGGGGAGGGGGG + Intronic
1105274553 13:18906954-18906976 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1107408137 13:40134303-40134325 CCAAGTCCTGAGAGAGAGGAGGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107787305 13:43969553-43969575 GCCAGTACCCAGGGGCAGGATGG - Intergenic
1112422051 13:99261219-99261241 GCCAGTCCCCAGGGAGAAGAGGG + Intronic
1113593390 13:111515666-111515688 CCCAGTGCCCGGGGAGAGGAGGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114602590 14:23968857-23968879 CCCGGTCCTCAGAGGCGGGACGG - Exonic
1114606959 14:24005986-24006008 CCCGGTCCTCAGAGGCGGGACGG - Exonic
1114705980 14:24726928-24726950 CCCAGCCCACTGAGGAAGGATGG - Intergenic
1115953742 14:38752256-38752278 CCCAGACCACAAAGGGAAGATGG + Intergenic
1119087942 14:71754153-71754175 GACAGTCCGCAGAAGGAGGAAGG + Intergenic
1119259309 14:73228162-73228184 CCAAGTTCCCAGTGGGAAGATGG - Intergenic
1119312649 14:73662560-73662582 TCCAGCCTCCAGAGGGAGCATGG - Intronic
1119668048 14:76498836-76498858 CCCAGGCCACAGATGGGGGAGGG - Intronic
1119950252 14:78737572-78737594 CCCAGTCCTCAGGTGGAGGAGGG + Intronic
1121446288 14:93981197-93981219 CCAAGTCCTGGGAGGGAGGAAGG + Intergenic
1121521265 14:94587592-94587614 CCCAGCCCCCAGGGAGAGCATGG - Exonic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1122120278 14:99549547-99549569 CCCAGGCCCCAGAGAAATGAGGG + Intronic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122329524 14:100903301-100903323 CCCAGTCCCAAGCGTGAGGCTGG + Intergenic
1122626519 14:103087954-103087976 CCCAGTCCCCAGGGCAGGGATGG - Intergenic
1122691250 14:103533076-103533098 CCCAACCCCCTGATGGAGGAAGG + Intronic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1202929992 14_KI270725v1_random:27772-27794 GCCAGTCCACAGAGAGAGCAGGG - Intergenic
1124356332 15:28997615-28997637 GACAGTCCCTAGAGGGTGGATGG - Intronic
1124519029 15:30393817-30393839 CCCAGTCGCGAGTGTGAGGAAGG - Intronic
1124539627 15:30572429-30572451 CCCAGTCGCGAGTGTGAGGAAGG + Intergenic
1124577836 15:30925461-30925483 CCCAGTCTCCTCAGGGAGGAGGG - Intronic
1124759025 15:32435153-32435175 CCCAGTCGCGAGTGTGAGGAAGG - Intergenic
1125501711 15:40243865-40243887 TCCAGTCCCCAAAAGGAGTAGGG - Intronic
1126166680 15:45659504-45659526 CCCAGGCTGCAGAGGGAGCATGG - Intronic
1127053965 15:55113292-55113314 GCCAGGCCCCTCAGGGAGGAAGG + Intergenic
1127842739 15:62845046-62845068 CCCAGTCCAAACAGGAAGGAGGG - Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128028861 15:64461538-64461560 CCTCAACCCCAGAGGGAGGAAGG - Intronic
1128127730 15:65205261-65205283 CCCAGTGCCAGGAGGGAGGGTGG + Intronic
1128506780 15:68278188-68278210 CCCAGCCCGCGCAGGGAGGAAGG - Exonic
1128738072 15:70064737-70064759 CCCAGTCCCCAGGGTGGGGAGGG + Intronic
1129034831 15:72642653-72642675 CCCTGTCCCCAAGGGGAGTATGG + Intergenic
1129215051 15:74094563-74094585 CCCTGTCCCCAAGGGGAGTATGG - Intergenic
1129659571 15:77545511-77545533 CCCAGTCCCAAGAGGGAGCAGGG - Intergenic
1129775781 15:78235412-78235434 CACAGCCCCCAGAGGGAGTGTGG - Intronic
1130363268 15:83209483-83209505 CCCCGTGCCCACAGGGAGGCTGG - Intergenic
1130661119 15:85832075-85832097 GCCATTCCCAGGAGGGAGGAGGG - Intergenic
1130865558 15:87930487-87930509 CTCACTCCTCAGAAGGAGGAAGG + Intronic
1130866613 15:87938703-87938725 TCCAGTCCCCAGATGGATGCCGG + Intronic
1130981055 15:88812055-88812077 CCCACTCCTGAGCGGGAGGAGGG + Intronic
1131757041 15:95576040-95576062 CCCAGGACACAGTGGGAGGATGG - Intergenic
1132498633 16:275252-275274 CCCAGGGCCCAGTGGGAGGCAGG + Intronic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1132597923 16:761684-761706 CCCAGGCCCCAGAGGAAGTGGGG - Intronic
1132713189 16:1278312-1278334 CCCAGGCCAGAGAGGGAGGGAGG - Intergenic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1133988913 16:10689898-10689920 CCCAGCCCCCTGAAGGAGGCGGG - Intronic
1134803205 16:17104414-17104436 ACCATTCCACAGAGGGGGGATGG - Exonic
1135435708 16:22425473-22425495 CGCTGTTCCCAGAGTGAGGATGG - Intronic
1135771305 16:25220425-25220447 CCCAGGCCCCAGAGCCAGGGTGG - Intronic
1135860298 16:26050087-26050109 CCCAGTCTCCAGGGGGGAGAGGG - Intronic
1136020968 16:27439828-27439850 CCCAGGGCCCAGGAGGAGGAAGG - Intronic
1136114662 16:28087235-28087257 GCAAGCCCCCAGTGGGAGGATGG + Intergenic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136777001 16:32877333-32877355 CCCAGTCCCCAGAAGGGTGCCGG + Intergenic
1136893615 16:33984180-33984202 CCCAGTCCCCAGAAGGGTGCTGG - Intergenic
1138352279 16:56352391-56352413 CCCAGCCCCTAGAGGGACCAGGG - Intronic
1138413269 16:56856160-56856182 CCCAGTCCAGGGAGTGAGGAAGG - Intergenic
1138460260 16:57143744-57143766 CCCAGGCTCCCCAGGGAGGAGGG + Intronic
1138583770 16:57957692-57957714 TCTAGGCCCCAGAGAGAGGAAGG - Intronic
1140410292 16:74737123-74737145 CCCCCTCCCCAAAGGGAGGCTGG + Intronic
1141550459 16:84803413-84803435 CCTAGTCCCCCGAGGCAGGTAGG - Intergenic
1141558634 16:84852617-84852639 CCCAGGCACCAGGGTGAGGAGGG + Intronic
1142265897 16:89063854-89063876 GCCAGTCCAGAGAAGGAGGAAGG + Intergenic
1203079418 16_KI270728v1_random:1139442-1139464 CCCAGTCCCCAGAAGGGTGCCGG + Intergenic
1142606028 17:1081486-1081508 CCCAGTGTGCAGAGAGAGGATGG - Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143310314 17:5982345-5982367 CCCTGGCCCAGGAGGGAGGAAGG + Intronic
1143310441 17:5983576-5983598 CCCTGGCCCAGGAGGGAGGAAGG - Intronic
1143379692 17:6488302-6488324 GCCAGTCTGCAAAGGGAGGAAGG - Intronic
1143591682 17:7888895-7888917 CCTAGTTCCCAAAGGGAGCAGGG + Intronic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1146054819 17:29575775-29575797 CCCAGTGCCCACAGGGTGGCTGG - Intronic
1146974329 17:37098083-37098105 GCCAGGCCACAGAGGGAAGAGGG - Intronic
1147389976 17:40103189-40103211 TCCAGAGCCCAGAGGGTGGAGGG - Intergenic
1147793600 17:43027709-43027731 CCCAGTTCCCAGGTGGGGGAGGG + Intronic
1148031916 17:44627766-44627788 CCCAGGCCCCAGTCAGAGGAGGG + Intergenic
1148097184 17:45060757-45060779 CCCAGACTCCCGAGTGAGGAAGG + Intronic
1148200984 17:45749904-45749926 CTCAGATCCCAGTGGGAGGAAGG + Intergenic
1148236208 17:45970872-45970894 CACACTCTCCTGAGGGAGGAAGG - Intronic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1150005034 17:61463967-61463989 CCCAGGCCCCATAGGGGGGCTGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151680428 17:75620085-75620107 CCCTGCCCCCACAGGGAAGACGG - Intergenic
1152011761 17:77723327-77723349 CCCTGTCCCCAAAGGGAGTATGG + Intergenic
1152112708 17:78366001-78366023 CCCAATCCCCAGAGGGAACGAGG - Intergenic
1152149223 17:78588711-78588733 CCCAGTAGACAGAGGGAGGTGGG - Intergenic
1152509365 17:80774982-80775004 CCCAGGAGCCCGAGGGAGGAAGG - Intronic
1152609021 17:81306621-81306643 CACGGTCCCTAGAGGGAGGCAGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152809875 17:82376346-82376368 GGCAGTCGCCAGAGAGAGGATGG - Intergenic
1152937941 17:83151550-83151572 CCCAGCCCACAGGGCGAGGAGGG + Intergenic
1153401581 18:4688736-4688758 CCCAGTGCCCTAGGGGAGGAAGG + Intergenic
1153954065 18:10081176-10081198 TCCACTCCCATGAGGGAGGAAGG + Intergenic
1154466238 18:14644203-14644225 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1156892083 18:42202830-42202852 CCCACTGCCAAGAGGAAGGAGGG - Intergenic
1158974914 18:62702790-62702812 CCTAGGCCCCAAACGGAGGAGGG - Intergenic
1160146182 18:76367122-76367144 CCCATTCCCCTGAGGCTGGAAGG - Intronic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1160946229 19:1645223-1645245 CCCAGATCCCGGAGGCAGGAAGG + Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161341533 19:3745794-3745816 CCCACTCCTCAGGAGGAGGAGGG + Intronic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161568821 19:5018754-5018776 GCCAGTCCACAGAGGCAGGAAGG - Intronic
1161582621 19:5089005-5089027 GCCAGTGCTCAGAGGCAGGAAGG + Intronic
1162019798 19:7863173-7863195 CGCACCCCGCAGAGGGAGGAAGG + Exonic
1162268323 19:9594356-9594378 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1162657205 19:12140142-12140164 CGGAGTCCCCAGACGGGGGAGGG - Intronic
1162916500 19:13877131-13877153 CCCAGGCTCCAGAGAGGGGAAGG + Intronic
1162951518 19:14074239-14074261 CCCAGGAACCCGAGGGAGGAGGG - Intronic
1163243242 19:16076877-16076899 CCCAGGCCCAGGAAGGAGGACGG - Intronic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1163601991 19:18254895-18254917 GCCAATCCCCAAAGGGAGAATGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164931971 19:32182903-32182925 CCCAGTCCCTAGAGGAACAAGGG + Intergenic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1165596300 19:37013366-37013388 CCCATTCCCCAGACGATGGAGGG - Intronic
1165718668 19:38063419-38063441 CCCGGCCCCCAGCGGCAGGATGG + Intronic
1166096315 19:40541552-40541574 CCCAGTGCCCTAAGGGTGGATGG - Intronic
1166547283 19:43640778-43640800 CCCACTCCCAGGAGGGAGAAGGG - Intergenic
1166823614 19:45595924-45595946 ACCAATCCCCAGAGAGGGGACGG + Intronic
1167334351 19:48875367-48875389 GCCAGGCCCCTGGGGGAGGAGGG + Intronic
1167363537 19:49043106-49043128 CCCACTCCCCAGGATGAGGAAGG - Intergenic
1167627946 19:50604861-50604883 CCCAGTCCCCAGAGCCAGTGAGG - Intergenic
1168412482 19:56148336-56148358 CTGAGTCCCCAGTGGCAGGAGGG + Intronic
925093429 2:1173670-1173692 CCCAGGCTTCTGAGGGAGGAGGG - Intronic
925173406 2:1766590-1766612 CCCAGCCTGCAGAGGGAGCAGGG + Intergenic
926170538 2:10550335-10550357 CCCAGCCCCCAGAGGGCGGCCGG + Intergenic
926801425 2:16664194-16664216 GCCAGAGCCCAGAGGCAGGAGGG + Intronic
927146394 2:20169093-20169115 TCCACTCCCCACAGGGAGAAGGG + Intergenic
927640373 2:24841876-24841898 CCCAGGCACCACAGGGAGGGAGG - Intronic
927709448 2:25315530-25315552 CCGGGTCCCGAGAGGGTGGACGG + Intronic
928310368 2:30204737-30204759 CTCAGTCCCCAGATGGAAGAAGG + Intergenic
929557724 2:42936089-42936111 CCCTGTCCCCAGTGTGAGGGGGG - Intergenic
929589279 2:43134628-43134650 CCCCCACCCCCGAGGGAGGAGGG + Intergenic
930213855 2:48672520-48672542 CCCAGAACCCAGACAGAGGATGG + Intronic
931730640 2:65150259-65150281 ACCAGGGCCTAGAGGGAGGAGGG + Intergenic
932595736 2:73092554-73092576 CCCAGCCCTCAGAGGAAGGCGGG + Intronic
932624073 2:73284309-73284331 CCCCGCCCCGAGAGGGAGGCGGG - Exonic
933004085 2:76967864-76967886 CCCATTAGCCAGAGGGAGAATGG - Intronic
933078186 2:77955106-77955128 CCCAGTCCCCAGGGCCAGGGAGG + Intergenic
933733906 2:85479705-85479727 CCGAGCCTCCAGAGGGAGCACGG + Intergenic
934727246 2:96631328-96631350 CCCAGTCCTCTGGTGGAGGAGGG + Exonic
934858519 2:97744120-97744142 CCCAGTCCACACAGCTAGGAGGG + Intergenic
934937141 2:98473566-98473588 GCCAGTGCCCAGAGTAAGGAGGG - Intronic
934946675 2:98547424-98547446 CCCAGCCCCCAGGGGTGGGAGGG + Intronic
935048069 2:99499393-99499415 CCCAGAACTAAGAGGGAGGAAGG + Intergenic
935552953 2:104478133-104478155 CCCATTCCCCAGTGAGAGGAGGG + Intergenic
935676121 2:105596249-105596271 CCCTGTCCCCAGAGGATGCATGG - Intergenic
936051254 2:109225468-109225490 CCCAGTCCCCAGTGGGGAGTCGG - Intronic
936574966 2:113645302-113645324 CCCAGGTTCCAGAGGGAGCAAGG + Intergenic
936721715 2:115259163-115259185 CCTGGTGCCCAAAGGGAGGAAGG + Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937245218 2:120488129-120488151 CACAGACCTCAGAGGGAGGGTGG - Intergenic
937260122 2:120580083-120580105 CGCTGTCCCCAGAGGAAGGTGGG + Intergenic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
938232741 2:129675578-129675600 CCCAGTGAACAGAGAGAGGAAGG - Intergenic
938244969 2:129769391-129769413 CCCGGCCCCCTGAGGAAGGAGGG - Intergenic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
938761568 2:134430959-134430981 CCCAGCCCGCCGAGGGAGGACGG + Intronic
938878206 2:135556007-135556029 CCCTGTCCCAAGTGGGGGGATGG + Intronic
939982440 2:148797608-148797630 CCTAGGACCCAGAGAGAGGAAGG + Intergenic
940239134 2:151544200-151544222 CCCAGTTCCCAGAGGGATTTTGG - Intronic
940422919 2:153499849-153499871 CCCAGTCCCCTGAGAGTGCAGGG + Intergenic
941370302 2:164656562-164656584 CCCATTCCCTAGAGGGAAGTGGG - Intronic
941995396 2:171597048-171597070 CCCATACCCAAGAGGAAGGAAGG - Intergenic
942036224 2:172013267-172013289 CCCAGGCCTCTGAGGCAGGAGGG - Intronic
942936772 2:181566657-181566679 CCCAGACCCAAGAAGGAGGGTGG + Intronic
943667730 2:190627990-190628012 GCCAGTTCCCAGTGGGAGGAGGG - Intergenic
944077095 2:195744400-195744422 CCCTGCCCCCAGAGGTAGGCAGG - Intronic
946014321 2:216591773-216591795 CCCCGTCCCCTGAGACAGGAGGG + Intergenic
947151622 2:227122163-227122185 CCCAGACCCCAGAAGGGAGATGG - Intronic
947268058 2:228304314-228304336 CCCAGTTTCCTCAGGGAGGAAGG + Intergenic
947527334 2:230886647-230886669 TCCAGTCCCCACAGGGAACAGGG - Intergenic
947743626 2:232496635-232496657 GCCAGGCCCCAGGGGTAGGAGGG - Intergenic
947876285 2:233470168-233470190 CCCAGCCCACAGTGGGGGGAGGG - Exonic
947914073 2:233820477-233820499 CCCAGTCTCCAAGGGGAGAATGG + Intronic
947914646 2:233823390-233823412 CCAAGTCCCCAGGAAGAGGAGGG + Intronic
948468980 2:238165439-238165461 CCGAGTCCCCAAGAGGAGGAAGG - Intronic
948830920 2:240597883-240597905 CTCAGGTCCCAGAGGGTGGAAGG + Exonic
948868730 2:240787842-240787864 CCCAGGCCCCAGGTGCAGGAAGG - Intronic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1169226999 20:3863178-3863200 CTCAGTCCCCAGAGGAAGTAAGG + Intronic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1171123750 20:22585007-22585029 GCGAGTCCCCTGAGGAAGGAGGG + Intronic
1172188747 20:33048970-33048992 CCCATGCCACAGAGGAAGGAGGG + Intergenic
1172233629 20:33354215-33354237 CTCAGCCCCCAAAGGGAGAATGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174064165 20:47852746-47852768 CCCTGTCTACAGAGGGAGGAGGG + Intergenic
1174123802 20:48287988-48288010 CCCAGTGCCTAGAGGGAGGTGGG + Intergenic
1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG + Intergenic
1174398848 20:50264937-50264959 CCGGATCCCCAGCGGGAGGAGGG + Intergenic
1174487241 20:50869244-50869266 CCCAGTGCCCTGGGGGATGAAGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1175454579 20:59102256-59102278 TCTAGTCCCCACAGGGAGAAAGG - Intergenic
1175457821 20:59128491-59128513 GACAGTGCCCAGATGGAGGATGG + Intergenic
1175598679 20:60255543-60255565 CCCAACCCCCAGAGGAAAGAGGG + Intergenic
1176592009 21:8656354-8656376 GCCAGTCCACAGAGAGAGCAGGG - Intergenic
1176808350 21:13514393-13514415 CCCAGGCACCAGCAGGAGGAGGG + Intergenic
1177975069 21:27838142-27838164 CCCAGGTCCCAGAGGAAGGCTGG + Intergenic
1178613397 21:34107873-34107895 CCCAATCCCCAGACTGAGGCAGG - Intronic
1180183442 21:46128135-46128157 CCCACTCCCAGGAGGGAGAATGG - Intronic
1180199485 21:46215873-46215895 CCCAGGGCCCTGAGGGCGGATGG - Intronic
1180274858 22:10633483-10633505 GCCAGTCCACAGAGAGAGCAGGG - Intergenic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1180549324 22:16528399-16528421 GCCAGTCCACAGAGAGAGCAGGG - Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181802693 22:25357919-25357941 CTCAGCACCCAGAGGGAGGAAGG + Intronic
1182366801 22:29784603-29784625 GCCAGTCCCCAGGGAGAGGAAGG - Intergenic
1182424881 22:30266669-30266691 CCCAGTTCCCGGAGGGCAGAGGG + Intronic
1182685441 22:32119546-32119568 CTCAGGCCCCAGAAGGAGGAGGG + Intergenic
1183079341 22:35446652-35446674 GCCCGTCCGCAGTGGGAGGAAGG + Intergenic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183411998 22:37660297-37660319 ACCAATTCCCAGAGGCAGGATGG - Intronic
1183585194 22:38749371-38749393 CCCAGGCCCAAGAAGGAAGATGG + Intronic
1184254490 22:43279280-43279302 CTCAGGCCCCAGAGGCAGGGTGG + Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184497163 22:44848703-44848725 CCCAGTCCCCACTGGGAGCCCGG + Intronic
1184549587 22:45197370-45197392 CCCAGTCTGCAGGGTGAGGATGG - Intronic
1185105189 22:48864956-48864978 ACCTGTCCCAAGAGGGAAGAAGG - Intergenic
1185276713 22:49953081-49953103 CACAGCGCCCAGTGGGAGGAGGG + Intergenic
1185425208 22:50765573-50765595 CCCAGGTTCCAGAGGGAGCAAGG - Intergenic
949458084 3:4260832-4260854 CCTAATCCCCAGATGGAAGAAGG + Intronic
950125115 3:10505898-10505920 CCCGCTCCCCAGAAGCAGGAGGG + Intronic
950577050 3:13838225-13838247 CCCAGGGCCCAGAGGGACGTGGG + Intronic
951345464 3:21542925-21542947 CCCAGTCTTCAGATGAAGGAAGG + Intronic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
953797285 3:45995439-45995461 CCAAGACCCCGGAGGGCGGAGGG - Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954392507 3:50274996-50275018 CCGAGTCCTGAGAGGGAGGAGGG - Exonic
954795789 3:53160917-53160939 CCCAGGCCCCAGCGGGCGGAGGG + Intronic
955687787 3:61562945-61562967 CCCAGCCCCCAGAGAGAGGGAGG - Intronic
955894410 3:63684308-63684330 GTTAGTCCCCAGAGGGAGGTCGG - Intergenic
956667803 3:71658474-71658496 CCCAGCCCCCAGAATGAGGATGG + Intergenic
956722149 3:72127687-72127709 CCCAGATCCCAGTGGGATGAGGG - Intergenic
956813572 3:72888111-72888133 CCCAGTCCCCGGCGGGCGGGCGG + Exonic
957193484 3:77039675-77039697 CCCACTCCCCAGCGGGCGGGTGG + Intronic
960089310 3:113623336-113623358 CCCAGTCCCTTGAGGGGGAAGGG - Intronic
960477242 3:118144863-118144885 CCCTGCCCCCTGAGGAAGGATGG + Intergenic
960974539 3:123161654-123161676 TCCTGTCCCCAGAGGCAGGCTGG + Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961217433 3:125170962-125170984 CCTACTCCCCAGAGGGAGATCGG - Intronic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
961476688 3:127151118-127151140 CCCATTGCCCACAGGGAGGCTGG + Intergenic
962148712 3:132869949-132869971 CCCATACCTCAGAGGGAGGATGG - Intergenic
962279249 3:134037818-134037840 CCCAGGCCCCAGAGAAAGCAGGG - Intronic
962837151 3:139199545-139199567 CCAAGTCCCCTGGGGGAGGAGGG - Intronic
966143649 3:176785978-176786000 CCCAGTCCTCTGAAGGAGGAAGG + Intergenic
966787516 3:183635156-183635178 CCCAGTCCTTAGAAGGAGCAAGG - Intergenic
967557810 3:190878130-190878152 CCCAGTCCCCAGGGCCAGGGAGG + Intronic
968483607 4:848382-848404 CTCAGGCCCCTGACGGAGGAAGG + Intergenic
968503142 4:960399-960421 ACCAGTCTCCAGTGGGATGAGGG + Exonic
968648202 4:1750166-1750188 CCCACTCTGCAGAGAGAGGAGGG + Intergenic
968654966 4:1774509-1774531 CCCAGGCCCCAGAAGGAGGATGG + Intergenic
969262489 4:6042947-6042969 CCCAGACCCCAGAGGGAACGTGG - Intronic
969597025 4:8155344-8155366 CCTAGTCCCCAGACTGTGGACGG - Intronic
969641461 4:8401584-8401606 CCCAGCTCCCACAGGGAGGATGG - Intronic
970457140 4:16236012-16236034 CCCAGTCCCCACAGCAAGTAAGG - Intergenic
970675236 4:18441369-18441391 ACCAGTGATCAGAGGGAGGAGGG + Intergenic
973743990 4:53945812-53945834 CCCATACCCTAGAGGAAGGAAGG + Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
976144891 4:82032753-82032775 TCCTGACACCAGAGGGAGGAAGG - Intronic
980264674 4:130500054-130500076 CCAAATTCCCAAAGGGAGGAGGG - Intergenic
984833651 4:183999472-183999494 CCCAGTGGCCAGAGGGAGACAGG - Intronic
985811707 5:2094890-2094912 CCCAGTCACCAGACGGTGGGTGG + Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
987112671 5:14701845-14701867 CCCAGTGCCTACAGTGAGGAAGG + Intergenic
988269121 5:28991578-28991600 CCCTGCCCCCAGAGGCAGGCAGG - Intergenic
990492240 5:56313897-56313919 CCCAGGAGCCAGAGGCAGGAGGG + Intergenic
990513571 5:56511512-56511534 TCCAGTTCCCAGAGGCAGCAGGG - Intergenic
993307767 5:86291985-86292007 CCCTGTCCTCAGGGGGAGGGAGG + Intergenic
993379474 5:87190050-87190072 CCCAGGCACTAGAGGTAGGATGG + Intergenic
994185389 5:96809452-96809474 CCCAGTTCTCAAAGGGAAGAAGG - Intergenic
997523967 5:134540813-134540835 TCCAATCTCCAGTGGGAGGATGG + Intronic
997884146 5:137615535-137615557 CCCCCTCCCCAGAGGCAGGTAGG + Intergenic
998052003 5:139043603-139043625 GCCAGCCTCCAAAGGGAGGAGGG + Intronic
998506948 5:142679708-142679730 CCAAGGCCCAAGAGGGAAGAAGG - Intronic
998544758 5:143017344-143017366 CCCAGTTGCCAGGGAGAGGATGG + Intronic
998553600 5:143101703-143101725 TCCAGTTCCCAGAGAGAGGGAGG - Intronic
999247378 5:150162320-150162342 CCCAGGAGCCAGAGGAAGGAGGG + Intergenic
1001673590 5:173494086-173494108 CCCAGCCGGCAGAAGGAGGAAGG + Intergenic
1001684557 5:173583787-173583809 TCCAGGACCCAGAGGGAGGCAGG + Intergenic
1001686631 5:173598520-173598542 CCCAGCCCCCCGAGGGAGCAGGG - Intergenic
1001886273 5:175293388-175293410 CTCAGGCTCCAGTGGGAGGAGGG - Intergenic
1001978514 5:176021114-176021136 CACAGATCCCAGAGAGAGGAGGG + Intronic
1002073252 5:176693144-176693166 GCCACTCCCCAGAGTGGGGAAGG - Intergenic
1002210620 5:177596813-177596835 CCCAGAGGCCAGAGGGAGGGGGG - Intergenic
1002238903 5:177822648-177822670 CACAGATCCCAGAGAGAGGAGGG - Intergenic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1002718867 5:181246177-181246199 CTCAGTCCACAGCGGGAGGCGGG - Intronic
1003033614 6:2623739-2623761 CCCTGTCTCCCGAGGGAGAAAGG - Exonic
1004310836 6:14543519-14543541 CGCAGTCACCAAGGGGAGGAAGG + Intergenic
1004600397 6:17144637-17144659 CCCCATCCCTAGAGGAAGGAGGG - Intergenic
1005214523 6:23509612-23509634 CCCTGTCCTCACATGGAGGAAGG - Intergenic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1006454458 6:34123894-34123916 CCCAGCCCCCAGCCTGAGGATGG - Intronic
1006828714 6:36955919-36955941 CCCAGTCACCTGAGGGTGGCTGG - Intronic
1006898379 6:37484753-37484775 TCCAGTCCCCAGAACCAGGAAGG - Intronic
1007267132 6:40605062-40605084 CCAAGTCCCAAGAGGGTAGAAGG - Intergenic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1007988950 6:46234908-46234930 CCCATTCTCAGGAGGGAGGAGGG + Intronic
1013293148 6:108736055-108736077 CTCAGTCCCCATTGGCAGGAGGG + Intergenic
1013615586 6:111840026-111840048 TCCAGTCCCCAGAGCGGGCAAGG - Intronic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1015556664 6:134469300-134469322 ACCAGCCCACAGAGGGAGCAGGG + Intergenic
1016280499 6:142412402-142412424 CCCAGTCCCCACAGGAAGAAGGG - Intronic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1016907786 6:149168922-149168944 CACAGTTCCCAAGGGGAGGAGGG + Intergenic
1016947869 6:149550893-149550915 CCCAGTTTCCTCAGGGAGGAAGG + Intergenic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019215527 6:170440501-170440523 CCCAGGCTCCTGACGGAGGACGG - Intergenic
1019359492 7:597462-597484 CCCAGTTCCTGGAGGGAGGCTGG + Intronic
1019429619 7:992665-992687 CCCAGGTCCCAGAGTGAGGCCGG - Intergenic
1019577495 7:1744511-1744533 GCCAGCCCCCAGAGGGATGGAGG - Exonic
1022016117 7:26349950-26349972 CCCAGTGCCCTTATGGAGGAGGG - Intronic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1023878538 7:44306033-44306055 CCAAATACCCAGAGGGAGGGGGG + Intronic
1023983428 7:45082298-45082320 CCCAGTCCCCAGAGGCTGTGTGG + Exonic
1025943053 7:66087581-66087603 CACAGTCCCAGGAGGGAGGCAGG - Intronic
1026968863 7:74455732-74455754 CCCACACCCCAGAGGCAGGATGG - Intronic
1028871410 7:95774370-95774392 CACAGTCCCCTGGAGGAGGAGGG + Intronic
1029189784 7:98763311-98763333 CCCAGTCCCCAGAGTTAAAAGGG + Intergenic
1029625407 7:101717683-101717705 CCCAGGTCCCAGTGGGAGTATGG - Intergenic
1030361475 7:108599664-108599686 TCCAGTCCCCAGAGGGCTAATGG + Intergenic
1031031299 7:116738383-116738405 ACCAGTACCCAAAGGGAGGTGGG + Intronic
1032145995 7:129381304-129381326 CCCAGTCCCCATAGGCAGGGAGG + Intronic
1032387508 7:131534592-131534614 GCCAGGCCCAAGAGGGAGAAGGG - Intronic
1032750997 7:134841620-134841642 TCCAGTGCCCAGAGGGATGGAGG - Intronic
1033097995 7:138447678-138447700 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1033216904 7:139499965-139499987 CCGACTCCCCAGAGGAAGGCTGG - Intergenic
1034270685 7:149802239-149802261 CCCTGCTCCCAGAGGGAGGTGGG + Intergenic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034437157 7:151068151-151068173 CCCAGAGCCCAGAGGAAGCATGG + Intronic
1034615023 7:152408713-152408735 CACAGACCCCAGGGGGAGCACGG - Intronic
1035220778 7:157405455-157405477 CCCAGTCACCACGAGGAGGAAGG - Intronic
1035245843 7:157561514-157561536 TCAGGGCCCCAGAGGGAGGATGG - Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036104868 8:5828511-5828533 CCCAGAACTAAGAGGGAGGAAGG - Intergenic
1036466498 8:9002820-9002842 CGCAGTCCACAGGGGGAGGGAGG - Exonic
1036576066 8:10028704-10028726 CACAGGCCCAAGAGTGAGGAAGG - Intergenic
1036651235 8:10645544-10645566 TCCAGCCCTCGGAGGGAGGATGG + Intronic
1036662701 8:10718093-10718115 CACAGTCCCCAGGGGAAAGAAGG + Intergenic
1036752543 8:11452465-11452487 GACAGTCCCCAGAGGGAGAGGGG + Intronic
1039469116 8:37802707-37802729 TCCAGGCCCCAGAGGATGGATGG - Intronic
1039972085 8:42328624-42328646 CCCAGTCCTCAGAGGAAACATGG + Intronic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1041275938 8:56157422-56157444 CCCAACCCCCTGAGGGAGGAGGG + Intergenic
1041936199 8:63334745-63334767 TGCAGGCCCCAGATGGAGGATGG - Intergenic
1042211092 8:66381329-66381351 CCCAGCCCCCACTTGGAGGAAGG + Intergenic
1043136393 8:76531673-76531695 TCCAATCCCCTGAGAGAGGAAGG + Intergenic
1046808635 8:118507885-118507907 CCCAGTACCCTGAGGGAGGGTGG + Intronic
1048328122 8:133454070-133454092 GGCAGCCCCCAGAGGAAGGATGG - Intergenic
1048831519 8:138482113-138482135 CCCAGACTATAGAGGGAGGATGG + Intronic
1049100883 8:140578118-140578140 CCCAGTGCCGAGGGTGAGGAGGG + Intronic
1049251937 8:141593931-141593953 CCCAGTTCCCACAGGGGGAACGG + Intergenic
1049747687 8:144269939-144269961 CCCAGTGCCCAGTGGAGGGAGGG - Intronic
1049759514 8:144325746-144325768 CCCACTCCCCACCTGGAGGATGG + Intronic
1050152788 9:2633755-2633777 CACAGTCCCCAAAGGTAGTAAGG + Intronic
1051671602 9:19516092-19516114 CCCAGAGCCCAGAGTGTGGAGGG + Exonic
1052861353 9:33439763-33439785 CCCAGGCCCTGGGGGGAGGAAGG - Intergenic
1052970399 9:34373789-34373811 CCCTGTCCCCAGAGGGGGAGAGG + Intronic
1052995980 9:34551858-34551880 CCACCTCCCCTGAGGGAGGAAGG + Exonic
1055493020 9:76825513-76825535 CCCCATCCCCAGGGGCAGGAGGG - Intronic
1055854535 9:80669988-80670010 CCCAGGCCAAAGAGGGAGAAGGG - Intergenic
1055997876 9:82181232-82181254 CCCACTCCCCATAGGTAAGATGG + Intergenic
1056063982 9:82914713-82914735 GCCAGTCCTGTGAGGGAGGAAGG + Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056720022 9:89063540-89063562 CCTACTTCCCAGAGGGATGAAGG + Intronic
1056764533 9:89436688-89436710 CCCAGTCCCAAGGCTGAGGAAGG + Intronic
1056778470 9:89531805-89531827 TCCAGGCCCCAGAGGGATGCAGG - Intergenic
1057789062 9:98110656-98110678 CTCACTCCCCACAGGGAGCAGGG + Intronic
1058599548 9:106654252-106654274 CCCAGCCCCCAAATGGAGTAAGG - Intergenic
1058935083 9:109762849-109762871 CCCATTCCCCAGGGGGTGGAGGG + Intronic
1059438806 9:114291249-114291271 CCCAGTGCCGCGTGGGAGGAGGG + Intronic
1059459038 9:114418146-114418168 CACAGTCCCCACCGGCAGGAAGG + Intronic
1059459340 9:114420007-114420029 CACAGTCCCCACCGGCAGGAAGG + Intronic
1059752327 9:117259435-117259457 CCAAATTCCCAAAGGGAGGAGGG - Intronic
1060142376 9:121221396-121221418 CCCAGCCCCCAGAAGGAGAGAGG + Intronic
1060183869 9:121552110-121552132 CCCAGCACCCAGAGGGTGGCTGG + Intergenic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1060660480 9:125402402-125402424 CTCAGTTGCCAGGGGGAGGATGG + Intergenic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1061038762 9:128127841-128127863 CCCAGTCCCGAGAGCGCTGAGGG - Exonic
1061283468 9:129610088-129610110 CGCAGACCACAGATGGAGGACGG - Intronic
1061284485 9:129614250-129614272 CCAAGGCCCCAGAAGCAGGATGG - Intronic
1061388305 9:130303279-130303301 CCCAGGACTCAGAGAGAGGAAGG + Intronic
1061482708 9:130904836-130904858 CCCTGACCCCAGAGGGCCGAAGG + Intronic
1061818280 9:133208791-133208813 CCCAGCCCCCAGTGGAAGGAGGG + Intronic
1062242172 9:135546567-135546589 CCCAGCCCCCAGTGGAAGGAGGG - Intronic
1062292939 9:135805515-135805537 CCCAGCACCCACAGGGAAGATGG + Intergenic
1062353503 9:136151098-136151120 GGCAGTCCCCAGAGTCAGGATGG - Intergenic
1062711514 9:137977709-137977731 CGCCGCCCCCTGAGGGAGGAGGG + Intronic
1203775441 EBV:70494-70516 CCCAGTGCCCGGAGAGAGAATGG + Intergenic
1203622058 Un_KI270749v1:135201-135223 GCCAGTCCACAGAGAGAGCAGGG - Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185784121 X:2875403-2875425 CCCAGTTCAGAGAGGGTGGAGGG + Intronic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1186512292 X:10139058-10139080 CGCAGCCCACAGAGGGAGAAGGG - Intronic
1187554768 X:20341230-20341252 CCCAGACCCCACTGGGAGTATGG + Intergenic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1189316862 X:40062710-40062732 CACAGGCCCCAGAGGGAAGCCGG + Intronic
1189462501 X:41253755-41253777 GACAGTCCCCCGAGCGAGGACGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192506729 X:71690220-71690242 CCCAGTCACCAGAGAGAGGGAGG + Intergenic
1192519968 X:71791326-71791348 CCCAGTCACCAGAGAGAGGGAGG - Intergenic
1192539084 X:71953073-71953095 CCCACTCCCCAGAGACAGGCTGG - Intergenic
1193042227 X:77016105-77016127 CCAAATCCTCAAAGGGAGGAAGG + Intergenic
1195465635 X:105176270-105176292 CCCATTTCCCAGAGGGAAAAAGG + Intronic
1199608224 X:149593425-149593447 CCCAGTCCCCAAAGGAAGCTGGG + Intronic
1199630896 X:149775935-149775957 CCCAGTCCCCAAAGGAAGCTGGG - Intronic
1199856245 X:151761282-151761304 TCCAGACCCCAGAGAAAGGAGGG - Intergenic
1200073962 X:153542194-153542216 CTCGTTCCCCAGAAGGAGGAGGG + Intronic
1200102858 X:153696710-153696732 CCCAGTCCCCAGAAGGGTGCCGG - Intergenic
1201756673 Y:17494040-17494062 CCCAGTTCCCGGAGGGAGGGAGG + Intergenic
1201844880 Y:18411944-18411966 CCCAGTTCCCGGAGGGAGGGAGG - Intergenic
1202027692 Y:20541806-20541828 TCCATTCCCAATAGGGAGGAAGG + Intergenic