ID: 1173265363

View in Genome Browser
Species Human (GRCh38)
Location 20:41474368-41474390
Sequence TCCCATGATCTCCAACGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173265363_1173265364 6 Left 1173265363 20:41474368-41474390 CCTTTACGTTGGAGATCATGGGA 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1173265364 20:41474397-41474419 CAGAAGATATAGCAGCAATCTGG 0: 1
1: 0
2: 1
3: 13
4: 175
1173265363_1173265365 17 Left 1173265363 20:41474368-41474390 CCTTTACGTTGGAGATCATGGGA 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1173265365 20:41474408-41474430 GCAGCAATCTGGACAGCTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 189
1173265363_1173265366 18 Left 1173265363 20:41474368-41474390 CCTTTACGTTGGAGATCATGGGA 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1173265366 20:41474409-41474431 CAGCAATCTGGACAGCTGCTGGG 0: 1
1: 0
2: 4
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173265363 Original CRISPR TCCCATGATCTCCAACGTAA AGG (reversed) Intronic
900689853 1:3973877-3973899 TCCCAGGATGTCAAACGTTATGG - Intergenic
904974045 1:34442414-34442436 CCCCATGATCTCCTAGGTGAGGG + Intergenic
911538922 1:99134982-99135004 TCCCTTGATATCAAACTTAATGG + Intergenic
913071022 1:115298631-115298653 TCCCATGTGCTCCAAAGCAATGG - Intronic
915982683 1:160431074-160431096 TCCCATGAGCTCCAAGGGGAGGG - Intergenic
1078851894 11:15171593-15171615 GCCCCTGATCTCCAACGGAAAGG + Intronic
1079863264 11:25701229-25701251 TCCCATGATCTCAAACCAAAAGG - Intergenic
1081599188 11:44480820-44480842 GCCCATGATCACCAACAGAAAGG - Intergenic
1089649828 11:119905534-119905556 TCCCCTCATCTCCAATGCAAGGG - Intergenic
1091236003 11:134022555-134022577 TCTAATGATCTCCAGGGTAAAGG + Intergenic
1094487265 12:30935018-30935040 TCCCATGATGACCAAAGAAAGGG - Intronic
1096358747 12:50965470-50965492 TCCCCTGACCTGCAAAGTAAGGG - Intronic
1097447760 12:59693979-59694001 TCCCATGAACTCCAAGGAACTGG - Intronic
1108778342 13:53795364-53795386 TCCAAGGACCTCCAACATAACGG - Intergenic
1110958098 13:81582297-81582319 TCCCATTGTCTCTAATGTAAGGG - Intergenic
1111841725 13:93457591-93457613 TTCCATGATCTCCCAAGTAAGGG + Intronic
1113329587 13:109315503-109315525 TGCCATGATCCAGAACGTAAGGG + Intergenic
1119354133 14:73991226-73991248 TCCTATGATCTCATCCGTAAAGG + Intronic
1119763979 14:77176502-77176524 TCCCATCATCTCCAACCCCATGG + Intronic
1125165906 15:36704038-36704060 TCCCTTCATCTACAACGAAAAGG + Intronic
1126440170 15:48679143-48679165 CCCTATGATATCCAAGGTAAAGG + Intergenic
1130026764 15:80277023-80277045 TCCCAGGCTCTCCATCGTGAGGG + Intergenic
1130313958 15:82779287-82779309 TCCCATGATCAGCAACTTGAGGG - Intronic
1143715169 17:8762415-8762437 AACCGTAATCTCCAACGTAATGG + Intergenic
1151427950 17:74043411-74043433 TCCCATGATGTCCAGCGGATGGG + Intergenic
1153654371 18:7269972-7269994 TACCATGGTCTCCAAAGTATAGG - Intergenic
1154968913 18:21387265-21387287 TCCAATTATCTCCAACTTGAAGG - Intronic
1159527744 18:69615330-69615352 TCCCATTATCCCCAAAGTAATGG - Intronic
1160070920 18:75626957-75626979 TATCATCATCTCCAACTTAATGG - Intergenic
1165599083 19:37037498-37037520 TCCTATAATCTCCAAAATAATGG - Intronic
929901983 2:46012680-46012702 TCCCATGATCCACCACGTACAGG - Intronic
1170418914 20:16173070-16173092 ATCCAAGATCTCCAACCTAAGGG - Intergenic
1172930437 20:38582552-38582574 CCCCATGATCTCAAATGTAGGGG + Intronic
1173265363 20:41474368-41474390 TCCCATGATCTCCAACGTAAAGG - Intronic
1174952248 20:55055069-55055091 TCCCATGATCTCCCATGAAAAGG + Intergenic
1177605505 21:23372320-23372342 TCCCAAGATATCAAAGGTAAAGG - Intergenic
1177888764 21:26779179-26779201 ACCCATCATCACCAATGTAATGG + Intergenic
1178625813 21:34217568-34217590 TCCCATGGTCTAGAACCTAATGG - Intergenic
949967432 3:9369590-9369612 TGCCAGGATCTCCAACATATAGG - Intronic
955586948 3:60489372-60489394 TCCAATAATGTCCAACTTAATGG + Intronic
966416443 3:179694419-179694441 GCCCATGATTTCCAACCTCATGG + Intronic
967472296 3:189876041-189876063 TCCCATGGTCTACAATTTAATGG + Intronic
970608968 4:17708262-17708284 TTCCAAGTTCTCCAACGTTAGGG + Intronic
972699446 4:41480109-41480131 ACCCATGATTTCCAACCTACAGG + Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
977054321 4:92171000-92171022 TCCCATGATCTTCATTGTCATGG - Intergenic
984617108 4:181911242-181911264 TCCAATGAACTCCAAAGAAAAGG + Intergenic
987996203 5:25283600-25283622 TACTATGTTCTCCAATGTAAAGG - Intergenic
988871215 5:35392174-35392196 TCCCTTGATCTTCCCCGTAATGG + Intergenic
996429693 5:123359618-123359640 TCCCATGATATCAAACTTAAGGG + Intronic
998488557 5:142525487-142525509 TTCCATGACCACCAAGGTAAGGG + Intergenic
1000252319 5:159507286-159507308 TCCCATCATTTCCAACGACAGGG + Intergenic
1002960433 6:1909454-1909476 TCCCAGGATTTCTAAAGTAAAGG - Intronic
1007271147 6:40638133-40638155 TTCCATGCTCTCCAAAGTCAGGG + Intergenic
1040880055 8:52194624-52194646 TCCCATCATCTGCACAGTAATGG - Intronic
1045446124 8:102266180-102266202 TCCCATGTTCTGCAAGATAATGG - Intronic
1045556574 8:103220121-103220143 TCCCATTATCTGAAACTTAATGG + Intronic
1052282376 9:26748071-26748093 TCCCATAATCTCCACTGTCACGG + Intergenic
1055067048 9:72129646-72129668 TCCCAGGATTTCCCAGGTAAAGG + Intronic
1057725012 9:97562289-97562311 TCCCATCATCTCCATCCTAATGG - Intronic
1187349129 X:18495807-18495829 TCCCCAGATCTCCTACCTAAAGG + Intronic
1187590452 X:20711868-20711890 TCCCATGACCCCCAACTGAAGGG - Intergenic
1193079941 X:77396846-77396868 TCCCATAAACTCCAACGCTAAGG + Intergenic
1201796763 Y:17904667-17904689 TTCCATGACCTCCAAGGTGAGGG - Intergenic
1201804790 Y:18001318-18001340 TTCCATGACCTCCAAGGTGAGGG + Intergenic
1202358142 Y:24073729-24073751 TTCCATGACCTCCAAGGTGAGGG - Intergenic
1202512636 Y:25596384-25596406 TTCCATGACCTCCAAGGTGAGGG + Intergenic