ID: 1173267374

View in Genome Browser
Species Human (GRCh38)
Location 20:41496928-41496950
Sequence TTGTACCTATAGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173267374 Original CRISPR TTGTACCTATAGCAAGAGGA AGG (reversed) Intronic
904569046 1:31447065-31447087 TTGTAAGTATAGTAAGATGAGGG - Intergenic
905910285 1:41648728-41648750 TTGTACCAATGGCAAGACCAAGG + Intronic
905961340 1:42045023-42045045 TTGAACCAATAGGAAGAGGAGGG - Intergenic
909848756 1:80433814-80433836 TTATGCCTATGGAAAGAGGAGGG - Intergenic
910628568 1:89334588-89334610 TCGTACCTAGAGCAGGTGGAAGG + Intergenic
912069779 1:105795700-105795722 TTTTACCATTACCAAGAGGAAGG + Intergenic
918878312 1:190080642-190080664 TTGTACTAATAGCCTGAGGAGGG + Intergenic
919421801 1:197378896-197378918 TAGTACCCAGAGCAAGAGCATGG + Intronic
920903517 1:210136444-210136466 TTGTAAGTATAGCCAGATGATGG + Intronic
922139453 1:222868000-222868022 CTGAACCTCTATCAAGAGGAGGG + Intergenic
924248639 1:242108978-242109000 TTTTGCCAAGAGCAAGAGGAAGG - Intronic
924737175 1:246768740-246768762 ATGTACCTCAAGCCAGAGGATGG - Intergenic
1064409486 10:15092810-15092832 TTGTACCTGTAGGAAAAGGCGGG + Intergenic
1067527635 10:47048049-47048071 ATGAAACTAAAGCAAGAGGAAGG + Intergenic
1067557532 10:47283231-47283253 TTGTACCTGCAGCAAGAAGCCGG + Intergenic
1078813139 11:14791777-14791799 TTGTACCCATGGGAAGGGGAGGG - Intronic
1079546629 11:21641104-21641126 TCTTACATATAGCCAGAGGAGGG - Intergenic
1081631898 11:44695077-44695099 ATGAACCTATGGCAAGAGGATGG - Intergenic
1083924102 11:65795577-65795599 ATGTACCTATGTCAAGAGAAGGG + Exonic
1085642636 11:78202273-78202295 TTGTACCATTAGCAAAAGAATGG + Intronic
1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG + Exonic
1088019219 11:105099416-105099438 TTGGACCTAGAGAAAGAAGAAGG + Exonic
1095559077 12:43543893-43543915 TTATAACTATAGTAAGAGCATGG - Intronic
1096952948 12:55494216-55494238 AATTACCTATAGCAATAGGAAGG + Intergenic
1097715148 12:62958400-62958422 TTGTAACTAAAGCAAGAGAATGG + Intergenic
1099826055 12:87779500-87779522 TTCTGCCTATAGGAAGTGGAGGG - Intergenic
1100934677 12:99649219-99649241 GTTTACCTATAGGAAGAGAAAGG + Intronic
1107165021 13:37273614-37273636 TTCTACCTAAAGGGAGAGGAAGG - Intergenic
1107178161 13:37423506-37423528 TTCTACCTGTGGAAAGAGGAGGG + Intergenic
1110041006 13:70758688-70758710 TTGTTCATATACCAAGCGGATGG + Intergenic
1110553086 13:76828975-76828997 CTCTACCTAAAGCAAGGGGATGG - Intergenic
1113140549 13:107144190-107144212 GTGTCCCTATAATAAGAGGAGGG + Intergenic
1115780913 14:36767008-36767030 TTGTACTTATAGCAATATAATGG - Intronic
1115933756 14:38528224-38528246 TTCTGGCTATAGCAAGGGGAAGG + Intergenic
1118536545 14:66772854-66772876 TTGTACACATACCAAGGGGACGG - Intronic
1119013044 14:71016798-71016820 TTGTTCTTCTAGCAAGTGGAAGG - Intronic
1119504590 14:75161587-75161609 TTGTATCTTTAGCAAGATGATGG - Intronic
1120534802 14:85681331-85681353 TTTTGTCTATAGCATGAGGAAGG + Intergenic
1121872563 14:97422500-97422522 TTATACCTATTGCATGAGAACGG + Intergenic
1130693791 15:86110020-86110042 TTGTACCACTAGCAAGAGGAAGG - Intergenic
1137913507 16:52403471-52403493 TTTTAGCTATAGGAAGAGGAAGG + Intergenic
1138872427 16:60907457-60907479 TTGTACATCTAGCTAGAGGTGGG + Intergenic
1139693592 16:68656987-68657009 TTCTACCCAGAGCAAGAGGTGGG - Intronic
1143850330 17:9806589-9806611 TTCTATCCATAGCAAAAGGAGGG + Intronic
1145376673 17:22355846-22355868 TTGGACCTAGAGCAGCAGGAGGG + Intergenic
1146616276 17:34359644-34359666 GTGGACATATAGGAAGAGGAGGG - Intergenic
1151198308 17:72447592-72447614 ATCTATCCATAGCAAGAGGAAGG + Intergenic
1152837262 17:82541686-82541708 TTGTACCTGTTTCAAGAGGTAGG + Intronic
1156021147 18:32600438-32600460 TTGTATCTTTAGTAAGAGAAGGG - Intergenic
928246730 2:29636226-29636248 TTGTACCTTTATCAAGAATATGG - Intronic
929397142 2:41535949-41535971 TTACACCTATGGCAAAAGGAAGG + Intergenic
930779835 2:55213561-55213583 TTGATCCTAGAGCTAGAGGAAGG + Intronic
933449350 2:82427208-82427230 TTGTACCTATAGACATAAGAAGG - Intergenic
939118541 2:138089081-138089103 TGGTTCCTTTAGCAAGAGCATGG + Intergenic
940601111 2:155861615-155861637 TTGTAAAAATAGCAAAAGGATGG + Intergenic
941958239 2:171227109-171227131 TTTTACCAATAGAAAGAGGGTGG - Intronic
942060329 2:172223455-172223477 GAGTAGCTATAGCAAAAGGAGGG - Intergenic
945243705 2:207699184-207699206 GTGTCCCTATAAGAAGAGGAAGG - Intergenic
948261555 2:236607760-236607782 GTGTCCCTAGAGGAAGAGGAAGG - Intergenic
1171501913 20:25600443-25600465 GTGTCCTTATAGGAAGAGGAAGG - Intergenic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
1173725916 20:45297811-45297833 TTGTAGTTATAGCCAGAGGTTGG - Intronic
1173871427 20:46344429-46344451 TGGTATCTCTAGCATGAGGAGGG - Intergenic
1179524228 21:41965412-41965434 TTGTTCCTACAGCAAAAGAAAGG + Intergenic
1179524414 21:41966389-41966411 TTGTTCCTACAGCAAAAGAAAGG + Intergenic
1179680530 21:43017907-43017929 TTGTAAGTATATCAAGAAGAGGG + Intronic
1184914563 22:47560536-47560558 TTGTACCTAGATCAAGGAGAGGG + Intergenic
965141641 3:164844561-164844583 TTGTACCTTTTGTGAGAGGAAGG - Intergenic
965788258 3:172359447-172359469 TTGTACCTAGAGTAAAGGGAAGG + Intronic
971889877 4:32506822-32506844 TTGTGCATACAGCAAGAGTATGG + Intergenic
971944772 4:33260112-33260134 TTTTATTTAGAGCAAGAGGAAGG - Intergenic
972114500 4:35612661-35612683 TTGAACGTATAGCAAGTGGTGGG + Intergenic
972610107 4:40648659-40648681 TTGTATCTCCAGCACGAGGATGG + Intergenic
975081046 4:70280903-70280925 CTGTGCCTATGGAAAGAGGAAGG + Intergenic
975360660 4:73466889-73466911 TTGTATGTATAGCTAGAAGAGGG - Intergenic
978987681 4:115034324-115034346 TAATACCTACAGCAAGTGGAAGG - Intronic
979383880 4:120041213-120041235 TTGAACCTGTAGCAGGAGAAAGG + Intergenic
983644397 4:169975228-169975250 ATGTACCAATATCAAGATGAGGG + Intergenic
983860577 4:172700864-172700886 GTGTATCTATGGAAAGAGGAGGG + Intronic
988158885 5:27493321-27493343 TTGTCTCTATGGAAAGAGGAAGG - Intergenic
988167288 5:27610205-27610227 TTACACCTATAGCAAGAGGTAGG + Intergenic
988575736 5:32422494-32422516 TTCTACCAAAAGCATGAGGAAGG + Intronic
990389166 5:55300973-55300995 GTGAACATATAGCAAGATGATGG - Intronic
990981132 5:61603191-61603213 TTGGTCCTAAAGCAAAAGGATGG - Intergenic
991574815 5:68091865-68091887 TTGTACCCATGGAAAGAGCAGGG + Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
996276852 5:121677447-121677469 TTGTATATATACCCAGAGGAGGG - Intergenic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
1001943302 5:175756049-175756071 TTGTTCTTACAGGAAGAGGAGGG - Intergenic
1005023109 6:21436459-21436481 TTGTAGCTATATAAAGAGAATGG + Intergenic
1005967999 6:30741328-30741350 TTTTACCTGTAGCCAGAGTAGGG + Exonic
1008870285 6:56264939-56264961 TTCTACCAATAGCAAAAAGAAGG + Intronic
1010719535 6:79266892-79266914 TTTTGCATATAGCATGAGGAAGG - Intergenic
1012332600 6:98011631-98011653 TTGTGCTTCTAGCAGGAGGAGGG - Intergenic
1012453251 6:99375867-99375889 TTGTATCTATAGCAATAAAATGG - Intronic
1014739650 6:125133593-125133615 TTTTGCTTATAGCATGAGGAAGG - Intronic
1017188612 6:151627713-151627735 TTGTACCTTTTACTAGAGGATGG + Intergenic
1019555127 7:1625498-1625520 CTGTACCTGTAGGAAGAAGAGGG + Intergenic
1019599264 7:1873339-1873361 TTGTAATTACAGCAAGAGGGTGG + Intronic
1020711012 7:11605161-11605183 ATGTACATATAGAGAGAGGAGGG - Intronic
1023041724 7:36178572-36178594 TGGTACCTAAAGGAAGAGCAAGG - Intronic
1023617936 7:42039896-42039918 CTGTGCCTATACCAAGAGGCAGG - Intronic
1024617108 7:51125238-51125260 CTGTACTTATAAGAAGAGGAAGG + Intronic
1024727971 7:52221056-52221078 CTGTTCCTCTAGCAAAAGGACGG + Intergenic
1029146974 7:98453414-98453436 GTGTACCAAGAGCAGGAGGAAGG + Intergenic
1030084470 7:105804896-105804918 TTGTACCTTTTTAAAGAGGACGG + Intronic
1032606769 7:133364022-133364044 TAGAGACTATAGCAAGAGGATGG - Intronic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1034260957 7:149755158-149755180 TTGTCCTTATAGGAAGAGGAGGG + Intergenic
1036952390 8:13153675-13153697 TTTTACCTCTAGCTAAAGGATGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1044938180 8:97313107-97313129 TTGTGGTTATAGCAAGAGGTGGG - Intergenic
1047784588 8:128141735-128141757 TTGTAAGTATAGCGAGAGGAAGG + Intergenic
1049008861 8:139874290-139874312 TTGGACCGATAGGAGGAGGATGG + Intronic
1054871879 9:70054625-70054647 TTGTTTCTATAGTAAGGGGAAGG + Intronic
1057020548 9:91693974-91693996 TTCTACCTACAGCAACAGGGAGG + Intronic
1058723579 9:107781202-107781224 TCCTACTTATAGCAAGGGGAGGG - Intergenic
1060226823 9:121796865-121796887 TTGGAACTAAGGCAAGAGGAAGG - Intergenic
1060854556 9:126904794-126904816 TGGGACCTATAGCAAGAGAAAGG + Intergenic
1188634742 X:32415123-32415145 TTTTGCCTTTAGCCAGAGGAAGG - Intronic
1189844658 X:45123279-45123301 TTTTGCATATAGCAAGAGGCAGG + Intergenic
1190628178 X:52357277-52357299 ATGTACCCAAAGCAAGAAGAAGG - Intergenic
1192127902 X:68519247-68519269 TTGTAGGTAAAGGAAGAGGACGG + Intronic
1192462214 X:71326415-71326437 TTTTACTTATAACAAGAAGATGG - Intergenic
1195172216 X:102280929-102280951 TTGTACCTTTGGGAAGGGGAGGG - Intergenic
1195186644 X:102406164-102406186 TTGTACCTTTGGGAAGGGGAGGG + Intronic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1196757078 X:119167450-119167472 GTGTAGCTACAGCAAGAGGATGG + Intergenic
1196995328 X:121376661-121376683 TCAGACCTATTGCAAGAGGAAGG + Intergenic
1197475652 X:126921287-126921309 TTGTACATATACCAAATGGAAGG + Intergenic
1198195519 X:134357042-134357064 TTGTACCTATAACAAAAAAACGG + Intergenic
1198480655 X:137036611-137036633 CTGTACCAATAGCTAGATGAGGG + Intergenic
1199503331 X:148534143-148534165 TTCTACCTATAGCAAAACAATGG + Intronic
1200880099 Y:8203535-8203557 TTCTACTTATAGTAAGAGGGAGG + Intergenic