ID: 1173271618

View in Genome Browser
Species Human (GRCh38)
Location 20:41541614-41541636
Sequence GTGAGATAAGTGAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173271614_1173271618 13 Left 1173271614 20:41541578-41541600 CCAGAGGAAGAAGAACCTACAGA 0: 1
1: 0
2: 0
3: 33
4: 251
Right 1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1173271615_1173271618 -2 Left 1173271615 20:41541593-41541615 CCTACAGAGTGAGAAGAAACAGT 0: 1
1: 0
2: 4
3: 42
4: 560
Right 1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173271618 Original CRISPR GTGAGATAAGTGAAGTTGGT GGG Intronic
903023310 1:20409692-20409714 GGGAGATAAATGAGGTTGGGTGG + Intergenic
903678452 1:25081506-25081528 GTGAGTGAAGTGACGTGGGTGGG - Intergenic
905857736 1:41325516-41325538 GTGAGATCAGAAAAGTAGGTAGG + Intergenic
907474438 1:54695999-54696021 GTGAGTCAGGAGAAGTTGGTGGG + Intronic
907551224 1:55306533-55306555 GTGAAAGAAGTGAATTTGCTTGG + Intergenic
910337597 1:86153043-86153065 CTGAAAGAAATGAAGTTGGTTGG - Intronic
910827842 1:91428319-91428341 CTGAGACAATTGAACTTGGTGGG - Intergenic
912120671 1:106467857-106467879 GTGACATCAGTGAACCTGGTGGG - Intergenic
914748704 1:150517622-150517644 GTGAGATACAAGAAGTTGGCAGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915647044 1:157279705-157279727 GTCTGATAAGTGAAGTTTGCTGG + Intergenic
917051119 1:170924744-170924766 GTGAGATAAATGATGTGGTTTGG + Intergenic
917257600 1:173132312-173132334 GTGAGATCAATGAAGAAGGTGGG - Intergenic
922508164 1:226139262-226139284 GTCAGCCAAGTTAAGTTGGTTGG - Intergenic
924056399 1:240128294-240128316 GTAAGATAAGTGTGGTTGGCTGG - Intronic
1063886712 10:10587312-10587334 GTGAAATGAGTGAAGCAGGTTGG - Intergenic
1063939821 10:11116619-11116641 GTGAGTTCAGCGAAGTTGGTTGG + Intronic
1064478676 10:15719131-15719153 GTGAGATGAGAGAAGGGGGTGGG + Intronic
1064979030 10:21147855-21147877 GTGAGTGAATTGAATTTGGTTGG - Intronic
1071297432 10:84232486-84232508 GTGAGGTCTGTGAAGGTGGTGGG - Exonic
1071521387 10:86333203-86333225 GAGAGATAAGAGATGGTGGTGGG - Intronic
1071954449 10:90742955-90742977 GGGAGAGAAGTGAAGTTTCTTGG - Intronic
1073048154 10:100652080-100652102 GTGAGACTGGTGAAGGTGGTGGG - Intergenic
1076240228 10:128899550-128899572 GTAAGAAATGTGAAATTGGTGGG + Intergenic
1076719775 10:132388007-132388029 GTGAGAAACGTGAATGTGGTTGG + Intergenic
1077359615 11:2134890-2134912 ATAAGACAAGTGCAGTTGGTGGG - Intronic
1078534015 11:12159089-12159111 GTGAGATAAGGGGAGGTGGAGGG - Intronic
1079652986 11:22953641-22953663 CTTATATAAGAGAAGTTGGTGGG - Intergenic
1082822378 11:57552761-57552783 CTGAGATAAGTGAGGTTTCTGGG + Intronic
1083036893 11:59646510-59646532 TTGAAAAAAGTGAAGTGGGTTGG - Intronic
1086308996 11:85515086-85515108 GTCAGATAACTGGAGTTGGTAGG + Intronic
1086880235 11:92145280-92145302 TTGAGATAAATGAAGCTGGATGG + Intergenic
1087218686 11:95522353-95522375 ACGTGATAGGTGAAGTTGGTGGG - Intergenic
1087525562 11:99306479-99306501 GTGAGCTAATTGAAGTTATTGGG - Intronic
1087732252 11:101792270-101792292 GTGGCAGAAGTGAAGTTGGAGGG - Intronic
1093122369 12:15287141-15287163 GTCAAATAGGTCAAGTTGGTTGG - Intronic
1093764559 12:22948135-22948157 GTGAGATTAATGAAGTTAGAAGG + Intergenic
1094139186 12:27163194-27163216 GTCAGCTTGGTGAAGTTGGTAGG - Intergenic
1097626565 12:62009204-62009226 GTCAGTTAAGTGAATTTGGGGGG + Intronic
1100083095 12:90876573-90876595 GTCCTATAAGTGAAGTTGATAGG + Intergenic
1101720213 12:107344367-107344389 GGGAGAGAAGGGAAATTGGTTGG + Intronic
1103995213 12:124825255-124825277 GTGAAATAAGTGGGGTGGGTGGG - Intronic
1109988349 13:70019420-70019442 CTGAGATAAGTGAAGCTAGCTGG - Intronic
1115117067 14:29894143-29894165 GTGAGCCAAGTGAAGTGGATGGG + Intronic
1117616412 14:57538007-57538029 GTGAGAAAAGTGAAGCTGACAGG - Intergenic
1121656052 14:95596441-95596463 GTGAGATAAGTGTAGTGCTTAGG + Intergenic
1123899550 15:24862866-24862888 ATGAGATAAGGGCAGTGGGTTGG + Intronic
1127005882 15:54569808-54569830 TTCAGATAACTGAAATTGGTAGG + Intronic
1127006112 15:54571799-54571821 GTGAAATACAGGAAGTTGGTGGG + Intronic
1127681978 15:61306275-61306297 GTGAGCTAGGTGAAGAGGGTGGG + Intergenic
1131090055 15:89617286-89617308 TTGCGAAAAGTGAAATTGGTGGG + Intronic
1132232334 15:100193378-100193400 GAGAGAGAGGTGAAGTGGGTGGG + Intronic
1133732178 16:8587463-8587485 GTTAGCCAAGTCAAGTTGGTGGG + Intronic
1134784663 16:16930716-16930738 GTGAGACAAGTGAGGTTCCTAGG + Intergenic
1134838144 16:17379235-17379257 GTGAGCTAACTGAAGTTAGCAGG - Intronic
1136072122 16:27793846-27793868 GGGAGAGAAGAGAAGTGGGTGGG - Intronic
1138063964 16:53921142-53921164 GTGAGACAAGTGAATATGTTTGG - Intronic
1140275974 16:73509332-73509354 GGGGGAGAAGGGAAGTTGGTAGG - Intergenic
1141259450 16:82439605-82439627 ATGAGATAAGCGAGGTAGGTAGG + Intergenic
1150686543 17:67325688-67325710 AAGAAATAAATGAAGTTGGTCGG - Intergenic
1155890901 18:31267555-31267577 GTCAGATAAGAAAAGTTTGTGGG - Intergenic
1159675771 18:71282993-71283015 GTGAGACAATCGAAGTTGGGAGG - Intergenic
1160213350 18:76903157-76903179 ATGAGCTAGGTGAAATTGGTTGG + Intronic
1166655010 19:44604748-44604770 GTGGGATAACTGAAAGTGGTGGG - Intergenic
1166951607 19:46432127-46432149 GTGGGAAAAGAGACGTTGGTTGG + Intergenic
928387549 2:30883263-30883285 GGGAGATAAGGGAAGTAGTTGGG + Intergenic
928400517 2:30974889-30974911 GAGGGATAAGTGAAGGTGGGAGG + Intronic
932708857 2:74047600-74047622 GTGGGACAGGTGAACTTGGTGGG - Exonic
932798434 2:74717903-74717925 GTGAGATTAGGGAAATTGTTTGG + Intergenic
933058214 2:77700608-77700630 GTAAGCTAAGGGGAGTTGGTGGG - Intergenic
936501381 2:113069536-113069558 GTGAGAGAAATGAAATTGGGAGG + Intronic
937132037 2:119521143-119521165 GTGAGTTAAGTGAGGTGTGTGGG - Intronic
939007802 2:136809390-136809412 TAGAGCTAAGTGAAGATGGTAGG + Intronic
939378933 2:141408833-141408855 TTGTGATAAGTGAAGGTGATAGG - Intronic
940973221 2:159916231-159916253 TGGAGATAAGTGTAGTTGGACGG - Intergenic
942558960 2:177200304-177200326 TTAAAATAAGTGAAGTTGGCTGG - Intergenic
943206309 2:184901462-184901484 ATGACATGAGAGAAGTTGGTGGG + Intronic
945396557 2:209325317-209325339 GGGAGCTAAGTGAAGATGGGAGG - Intergenic
945469647 2:210212691-210212713 GTCAGATAAGTGTGGTAGGTGGG - Intronic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948557872 2:238827509-238827531 GTCAGTTAAGTCAAGTTGGTTGG - Intergenic
1168743224 20:212898-212920 GTGTGATCAGAGAAGGTGGTAGG - Intergenic
1170697413 20:18671785-18671807 GAGAGAGAAGTGAGGTTGCTGGG + Intronic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1172017711 20:31888310-31888332 GTGAGAGATTTGAAGTTGGTGGG - Intronic
1173271618 20:41541614-41541636 GTGAGATAAGTGAAGTTGGTGGG + Intronic
1173693631 20:44986812-44986834 GTGGGAGAAGTGGAGTAGGTTGG + Intronic
1175249764 20:57602170-57602192 GTGAGCTAAGGGGAGTGGGTAGG + Intergenic
1176875343 21:14121439-14121461 GAGATATAAGTGCAGTTGGTCGG - Intronic
1177343749 21:19840696-19840718 GTGAGAGATGTGAAGATGTTTGG - Intergenic
1178427808 21:32492757-32492779 GAGAGATGAGGGAAGTTGTTAGG - Intronic
1182305142 22:29362771-29362793 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182312452 22:29418925-29418947 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG + Intergenic
1182750198 22:32635459-32635481 TTGAAATAAGTGAAGGTAGTGGG - Intronic
1183227407 22:36559922-36559944 GAGAGATAATTGAGATTGGTGGG + Intergenic
949225953 3:1696319-1696341 TTGAGATAATTGAAATTAGTGGG + Intergenic
949356969 3:3191157-3191179 GTGAGAAAAGTGAAATTACTGGG + Intergenic
951280036 3:20737046-20737068 GTGGGATAAGTGAACTTGAAAGG + Intergenic
951428556 3:22578669-22578691 GTCATTTAAGTCAAGTTGGTTGG - Intergenic
952109325 3:30104300-30104322 CTGAGATATGTGAATTTGTTGGG - Intergenic
952748849 3:36807578-36807600 GTAAGGTCAGTGAAGCTGGTTGG - Intergenic
953222117 3:40981333-40981355 GTCAGTTAGGTTAAGTTGGTTGG + Intergenic
955542393 3:59991488-59991510 GTGAGACAAGTGAAATTAGAAGG - Intronic
955609946 3:60746324-60746346 GAGAGATAATTGAAGGAGGTGGG + Intronic
957858623 3:85913669-85913691 GTAAGAGAAATGAAGTTTGTTGG - Intronic
959210184 3:103368988-103369010 CTGAGAGAAGTGAAGAAGGTGGG - Intergenic
959474705 3:106795305-106795327 GTGAGATAAGGGTAGTTAATGGG + Intergenic
959512672 3:107232177-107232199 AGGAGAAAAGTGAAGTTGGAGGG - Intergenic
962101379 3:132346331-132346353 GTGAGATGAATAAAGTAGGTTGG + Intronic
963302796 3:143617731-143617753 GATAGATAAGTGAAGTAGGCTGG - Intronic
970228561 4:13885126-13885148 GTGAGATGAGAGATGTTGTTGGG + Intergenic
974170069 4:58254969-58254991 GGGAGATAAATGAAGGAGGTTGG + Intergenic
975407928 4:74013412-74013434 GTGAGGTCAGAGAGGTTGGTAGG - Intergenic
976663699 4:87567234-87567256 GTGAGATAAGTGAAATGCATGGG - Intergenic
977066090 4:92317755-92317777 GTGAGACAAGTGAAGCTTTTGGG + Intronic
977319835 4:95499611-95499633 GCGAGAGAAGTGAAGTTGTGGGG + Intronic
978359050 4:107908732-107908754 GTGAGAGCAGTGAAGATGCTTGG + Intronic
981088437 4:140707922-140707944 GTAATATAAGTCAAGATGGTTGG - Intronic
981602754 4:146509100-146509122 GTGAGATATGTGAAAGTGGTTGG - Intronic
981919091 4:150067373-150067395 GTGAGAGAAGAGGAGTTGCTGGG - Intergenic
982278663 4:153662535-153662557 GTGAGGGAAGTGAAGTTGGGTGG + Intergenic
985011979 4:185592072-185592094 GTGAGGTGAGTGATGGTGGTGGG + Intronic
987294257 5:16536183-16536205 GCCAGAGAAGTGAAGTAGGTGGG - Intronic
987296861 5:16561089-16561111 GAAAGAGAAGTGAAGTTGGCAGG + Intronic
987694454 5:21310126-21310148 GGGAGAGAAGTGAAGTAGCTGGG - Intergenic
990510046 5:56481424-56481446 GCCAGAGAAGTGAAGTTGGGGGG - Intronic
991745789 5:69739345-69739367 GGGAGAGAAGTGAAGTAGCTGGG + Intergenic
991751917 5:69815888-69815910 GGGAGAGAAGTGAAGTAGCTGGG - Intergenic
991797389 5:70319303-70319325 GGGAGAGAAGTGAAGTAGCTGGG + Intergenic
991825167 5:70614659-70614681 GGGAGAGAAGTGAAGTAGCTGGG + Intergenic
991831204 5:70690789-70690811 GGGAGAGAAGTGAAGTAGCTGGG - Intergenic
991889732 5:71318630-71318652 GGGAGAGAAGTGAAGTAGCTGGG + Intergenic
992113771 5:73520161-73520183 GTGAGGTAAGTGGAATTCGTAGG + Intergenic
993176103 5:84488000-84488022 GTGAAATAAGAGAAAATGGTTGG + Intergenic
996613742 5:125414863-125414885 GTGAGAAAATGGAAGATGGTGGG + Intergenic
996887847 5:128379980-128380002 TTTACATAAATGAAGTTGGTGGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999700225 5:154221080-154221102 GTAAGATAAATGAAATAGGTAGG + Intronic
1000580844 5:163034124-163034146 ATGAGACAAGTGCAGATGGTGGG - Intergenic
1001767214 5:174259855-174259877 GTGAGATAAGTCTAATTGATTGG - Intergenic
1002273639 5:178089359-178089381 GTGAGAGAGGTGAGGGTGGTGGG - Intergenic
1004317058 6:14598869-14598891 CTGAGAGAAGTGAACTTGGGTGG - Intergenic
1005556453 6:26989809-26989831 GGGAGAGAAGTGAAGTAGCTGGG + Intergenic
1007731948 6:43952771-43952793 GTGAGATCAGAGAAGTAGGAGGG - Intergenic
1008095573 6:47336273-47336295 GAGTGATACGTGAAGTTGGAGGG - Intergenic
1008132166 6:47730796-47730818 CTCAGATAGGTGAAGTCGGTTGG + Intergenic
1008354231 6:50532708-50532730 GGGAAATAAATGAAGTTTGTTGG + Intergenic
1008879200 6:56363586-56363608 CAGAGATAAGTGAAGTTCCTAGG + Intronic
1009882528 6:69586241-69586263 GTGAGAGAAAAGCAGTTGGTTGG - Intergenic
1014504572 6:122239317-122239339 GTGAAATGAGTGAAGTTGGCAGG - Intergenic
1016571583 6:145519467-145519489 GGGAGAAGAGTGAAGTTGGAGGG - Intronic
1016593065 6:145767036-145767058 GTGAGATCAGTGCAGAAGGTGGG - Intergenic
1017729754 6:157304996-157305018 ATGAGGTCAGTGAGGTTGGTGGG + Intronic
1023315028 7:38927609-38927631 GTGAGAAAACTGAAATTAGTCGG - Intronic
1023350507 7:39315966-39315988 TTAAGATGAGAGAAGTTGGTTGG + Intronic
1026374749 7:69739141-69739163 GGGAGGGAAGTGAAGGTGGTGGG - Intronic
1028838530 7:95400612-95400634 GTGAGATATGTGAGGGTGATTGG + Intergenic
1030495199 7:110289993-110290015 GTGAGATCTGTGAGGTTGTTTGG - Intergenic
1032246325 7:130216885-130216907 ATGAACTAGGTGAAGTTGGTTGG + Intergenic
1032846755 7:135757947-135757969 GTCAGAGAGGTGGAGTTGGTGGG + Intergenic
1035096464 7:156360099-156360121 GTGAGATAAGGGGAGGTGGTTGG - Intergenic
1037449589 8:19003422-19003444 GTGAGAAGTGTGAAGTTGGGAGG - Intronic
1039785015 8:40826906-40826928 GTGAAACAAGTGGAGTTTGTGGG - Intronic
1040498720 8:47989305-47989327 GTCTGATAAGTGAAGTCTGTTGG + Intergenic
1043534422 8:81186622-81186644 AAGAGATAGGTGAAGTTGGTGGG - Intergenic
1045575493 8:103415512-103415534 GAGAGGTAAGATAAGTTGGTAGG + Exonic
1050105299 9:2159214-2159236 CTGAGATAAATGAAGTTGGGGGG - Intronic
1050298866 9:4236099-4236121 GTGAGAACAGTGAACTTGGTCGG - Intronic
1050952065 9:11610000-11610022 GAGATATAAGTGAGGTTGGTGGG + Intergenic
1051998362 9:23247481-23247503 GTGAGATAAATGCAGAAGGTGGG + Intergenic
1052248376 9:26366534-26366556 TTGAGATAAGTGAAGTTGAGAGG + Intergenic
1053385480 9:37683931-37683953 GTGAGGGAGATGAAGTTGGTGGG + Intronic
1056433944 9:86557113-86557135 GTGAGCTAAGTGAGGTGGGGAGG + Intergenic
1058172768 9:101702788-101702810 TTGAGAGAAGTGAATTTGGCAGG - Intronic
1059853016 9:118364491-118364513 GTGAGCCAAGTGCAGTTTGTTGG + Intergenic
1186117475 X:6320220-6320242 CAGAAATAAGTGATGTTGGTGGG + Intergenic
1188926820 X:36053990-36054012 TTGGGATCTGTGAAGTTGGTTGG + Intronic
1189101780 X:38197987-38198009 GTGAGATGAGGGAAGTAGGGTGG + Intronic
1193081686 X:77412431-77412453 GTGAGATCAGTGCAGAAGGTGGG - Intergenic
1194765470 X:97842978-97843000 GTCAGTTAAATGAATTTGGTCGG - Intergenic
1195211338 X:102654110-102654132 TTGAGACAAGTGCAGTGGGTGGG + Exonic
1200745026 Y:6896741-6896763 GTGAGAGGATTGAAGTAGGTGGG + Intergenic
1201590537 Y:15610400-15610422 GTGAGATCAATGAAGAAGGTGGG + Intergenic