ID: 1173273783

View in Genome Browser
Species Human (GRCh38)
Location 20:41560353-41560375
Sequence GACTCCTGCCCTGCTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173273777_1173273783 13 Left 1173273777 20:41560317-41560339 CCATTCATCCAACTATACTGAAC No data
Right 1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG 0: 1
1: 0
2: 3
3: 15
4: 196
1173273778_1173273783 5 Left 1173273778 20:41560325-41560347 CCAACTATACTGAACACCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG 0: 1
1: 0
2: 3
3: 15
4: 196
1173273776_1173273783 16 Left 1173273776 20:41560314-41560336 CCACCATTCATCCAACTATACTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG 0: 1
1: 0
2: 3
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173273783 Original CRISPR GACTCCTGCCCTGCTCATTC AGG Intronic
900302436 1:1984814-1984836 GCCTCCTGCCCTGCCCAGGCTGG + Intronic
900518390 1:3094118-3094140 GCCTCTTGCCCTGCACACTCAGG - Intronic
900561690 1:3310241-3310263 GACACCTGCCCGGCACACTCTGG + Intronic
901101638 1:6723641-6723663 GACTCCTTCCTTGCTTCTTCTGG - Intergenic
901353799 1:8624628-8624650 GACTCCTCCCCTTCTTCTTCAGG - Intronic
902641539 1:17769481-17769503 GAGTCCTGCCCTGGACATTGGGG + Intronic
903790802 1:25891743-25891765 GCCCCCTGCTCTCCTCATTCTGG + Intronic
906154369 1:43605507-43605529 GATTCCTGCCCTGCCCACCCAGG + Exonic
907048853 1:51316340-51316362 GCCTCCTGACCTGCCCATACTGG + Intronic
909383854 1:75034445-75034467 GACTCCTCCCTTGCTCAGGCTGG - Intergenic
910602265 1:89044132-89044154 GGCTCCTGCCCTGCCAACTCAGG + Intergenic
911815549 1:102344927-102344949 GCATCCTGCCCTCTTCATTCTGG + Intergenic
915283421 1:154837991-154838013 CACTCCTGCCCTCGTAATTCAGG - Intronic
916401052 1:164448824-164448846 CCCTACTGCCCTGCTCAGTCTGG - Intergenic
917016031 1:170532144-170532166 CACTGCTGCCCAGCTCATCCGGG - Exonic
917472709 1:175339508-175339530 GTCTCCTTCCCTGCTGATTTGGG + Intronic
918373793 1:183888070-183888092 GGCTGCTGCCCAGCTCATTTTGG + Intronic
918583864 1:186163489-186163511 GTCTTCTGCCTTGCTCATTCTGG + Intronic
918635027 1:186764895-186764917 TACCCCTGCCCTGCTCATTCTGG - Intergenic
918818294 1:189220446-189220468 CTCTCCTGCCCTGCTCATGTTGG + Intergenic
920088226 1:203433423-203433445 GAGTCCTGCCTTCATCATTCTGG - Intergenic
920356639 1:205378181-205378203 GAATCCTGCCTTGATCTTTCTGG + Intergenic
921260106 1:213378845-213378867 GTCACCTGCCATGTTCATTCTGG + Intergenic
922700178 1:227754696-227754718 GTGGCCTGCCCTGCTCCTTCAGG + Intronic
923331332 1:232927603-232927625 ACCTCCTGCTCTGCTCACTCAGG - Intergenic
1063295005 10:4796525-4796547 GACTCCAGCCCTGCTCAAATTGG - Intronic
1064209707 10:13351794-13351816 GTCACCTGCCCTTCTCATTCGGG + Intergenic
1065675824 10:28173156-28173178 TATTCCTGCCCTGCTCACCCTGG - Intronic
1066393569 10:34998149-34998171 TAGCCCAGCCCTGCTCATTCAGG + Intergenic
1070483084 10:76904306-76904328 AACTCCTGCCCTGGGCATTGTGG + Intronic
1070590541 10:77797593-77797615 TCCTCTTGCCCTGCTCTTTCTGG - Intronic
1071279644 10:84088774-84088796 AACACATGCCCTGCTCATGCAGG - Intergenic
1072298500 10:94036215-94036237 GAGTGCTGCTCTGCTCACTCTGG + Intronic
1073984038 10:109187446-109187468 GACTCTTGTCCTGCACATTATGG - Intergenic
1075010841 10:118868966-118868988 GCCTCTTGCCCAGCTCCTTCAGG - Intergenic
1075273230 10:121071078-121071100 GACCCCTGCCCCTCCCATTCAGG - Intergenic
1076260283 10:129059624-129059646 AACTCCTGCTCTGCCCATCCTGG - Intergenic
1076327536 10:129638003-129638025 GCCTCCTGCAGTGCTCAGTCTGG + Intronic
1076347156 10:129787070-129787092 GAGTCCTGGGCTGATCATTCAGG - Intergenic
1079102634 11:17551425-17551447 GACTCCTGCCCTGATACCTCAGG - Intronic
1081649306 11:44812987-44813009 GACACCAGGCCTGCTCTTTCTGG + Intronic
1082572812 11:54763479-54763501 GACTTTTGCCCTGCTCAACCAGG + Intergenic
1082814909 11:57501285-57501307 GCCACCTGCGCTGCTCATCCTGG + Exonic
1083871818 11:65493027-65493049 CCCTCCTGCCCTGGTGATTCAGG + Intergenic
1085512739 11:77096518-77096540 GCCTCCTGCCCTGCTCCTACGGG + Intronic
1087912720 11:103772381-103772403 GACTCATGCAATGCTCATCCAGG + Intergenic
1091262358 11:134244916-134244938 GACTCCTGCCCTCCCCCTACAGG + Exonic
1091585828 12:1816112-1816134 GATCCCTGCTCTGCTCGTTCAGG + Intronic
1094487168 12:30934262-30934284 GACTCCTGCTCTGCACCTGCTGG + Intronic
1095306767 12:40647785-40647807 GAAGACTGACCTGCTCATTCAGG - Intergenic
1096534438 12:52262348-52262370 GCCCCCTGCCCTGCTCTTTCAGG + Intronic
1101445635 12:104735058-104735080 GACTGTTGCCTTGCTCATCCTGG - Intronic
1104702801 12:130919973-130919995 CACACCTGCCCTGATCATTTGGG + Intergenic
1104948444 12:132427820-132427842 GACCCCTGCCCAGCTGAGTCCGG - Intergenic
1105753228 13:23441103-23441125 GCCCCCTGCTCTGCTCAGTCAGG + Intergenic
1110283566 13:73723563-73723585 AAGCCCTGCCCTCCTCATTCTGG + Intronic
1113299885 13:109006883-109006905 GACTCCTGGCCTGCTCATATTGG - Intronic
1115284672 14:31703996-31704018 CTCTCCTGCCTTGCTCATGCCGG + Intronic
1118773398 14:68957468-68957490 CACACCTGCCATGCCCATTCTGG + Intronic
1119943378 14:78665599-78665621 GAGTCCTGCCCTGACCACTCAGG - Intronic
1121525330 14:94615483-94615505 GGCTCCTGCCCTGCACATGTGGG + Intronic
1121561607 14:94880315-94880337 GACTCCAGCCCAGGTCTTTCCGG - Intergenic
1121831771 14:97058678-97058700 GACTCCAGCCCTGCAGATTTTGG - Intergenic
1121914522 14:97824544-97824566 GGCTGCTACCCTGCTCATACTGG - Intergenic
1124789490 15:32714230-32714252 ACCTCCTCCCCTCCTCATTCTGG + Intergenic
1125232303 15:37469638-37469660 GTCTTCTGCGCTGCTCATGCTGG + Intergenic
1126529190 15:49693169-49693191 GTCTCCTGCCCTGCTATTTTAGG + Intergenic
1127345694 15:58095672-58095694 GTCTCCTGCCCTGCTCTGACAGG + Intronic
1127859351 15:62980194-62980216 GTCTCCTGCATTGCTCACTCTGG - Intergenic
1128073402 15:64811215-64811237 TAATCCTGCCCTGGTCTTTCTGG - Intergenic
1129168121 15:73790873-73790895 CAGTCCTGCCCTCCTGATTCAGG + Intergenic
1131829292 15:96344084-96344106 GACTCCCTCCCTTCTCTTTCTGG + Intergenic
1132372144 15:101306576-101306598 GACTCCTGCACTGCACCTCCAGG + Intronic
1134105188 16:11480349-11480371 GATTATTGCCCTGCTCATCCTGG + Intronic
1135299093 16:21310293-21310315 GACTCCTGCCCTGCTCATCTCGG + Intergenic
1138542138 16:57694937-57694959 GCCTCCAGCCCTGATCTTTCTGG + Intronic
1140514913 16:75534883-75534905 GACCCCTGCCCTGCGCAGTGAGG + Intronic
1147266183 17:39236442-39236464 GGCTCCAGCCCTGCTCAGACAGG + Intergenic
1150814024 17:68378559-68378581 GACTCGTGCCCTTCTTCTTCGGG - Intronic
1150907517 17:69354070-69354092 GATTCCTTCCCTGCTCATCAAGG + Intergenic
1151198754 17:72452368-72452390 GGCTCCTGCCTTTCTCATTAGGG - Intergenic
1152205949 17:78974477-78974499 GACTCCTCCCCAGCCCCTTCTGG - Intronic
1153174281 18:2353113-2353135 GACTCCTGCCATTTTCATTGGGG - Intergenic
1153442211 18:5132995-5133017 GATTCCAGTCCTGCTCATCCAGG + Intergenic
1153941626 18:9983208-9983230 GTCTCCTGCCTTGATCATGCTGG + Intergenic
1157082041 18:44535863-44535885 AACTCCTGCTCTGGCCATTCGGG - Intergenic
1157629834 18:49083516-49083538 GAATGCTACCCAGCTCATTCAGG - Intronic
1160010425 18:75103272-75103294 AGCTCCAGCCCTGCTCATTGTGG + Intergenic
1160236875 18:77092866-77092888 GCCTGCTGCCCTGCTCAGTGGGG + Intronic
1164116678 19:22227986-22228008 GACTCCTCCCTAGCTCATTTTGG + Intergenic
1164805314 19:31111858-31111880 GACTTCTGTCCTGCTGTTTCTGG + Intergenic
1165824664 19:38698882-38698904 GTCGCCAGCCCTGCTCATTCAGG - Intronic
1166663103 19:44660062-44660084 CACTCCAGCCTTGCCCATTCTGG + Intronic
1166675595 19:44738847-44738869 GCCCCCTGCCCTGCTCATTCGGG - Intergenic
1167204265 19:48089715-48089737 TTCTCCTGCACTGCTCACTCTGG - Intronic
925115024 2:1371401-1371423 GAATCCTGCCCTGCCCTTGCTGG + Intergenic
925295653 2:2774750-2774772 GACTCCTTCCCTGGCCATTCAGG + Intergenic
925571070 2:5313472-5313494 GATTCCTGCCCTGCTCTTAGAGG - Intergenic
925670969 2:6309488-6309510 AACTCCTGACTTGCACATTCTGG - Intergenic
925743915 2:7029077-7029099 GACCCCTGACCTGCTCCTCCTGG + Intronic
926068148 2:9861011-9861033 GTCTTCTGCGCTGCTCATGCTGG - Intronic
926303342 2:11619067-11619089 GAGTCCTGCCCTCCTCCCTCCGG - Intronic
930053331 2:47233975-47233997 CTGTCCTGCCCTGCTCCTTCAGG + Intergenic
931442142 2:62297609-62297631 TACTCCTGCCTTGGTCTTTCTGG - Intergenic
932422600 2:71610531-71610553 GATTCCTGCCCAACTCTTTCTGG + Intronic
932611527 2:73203307-73203329 GCCTCCTGCCCACCGCATTCAGG - Intronic
932913366 2:75829090-75829112 TACACCTGCCCTGCTCTCTCGGG - Intergenic
933706862 2:85297809-85297831 GACACCTTCCCTGGTCATCCTGG + Intronic
933881399 2:86673562-86673584 CACTGCTGCCCTGCTTCTTCAGG + Intronic
933917522 2:87011071-87011093 CACTCCTGCCCTTCACACTCAGG + Intronic
934005474 2:87758846-87758868 CACTCCTGCCCTTCACACTCAGG - Intronic
934768257 2:96892620-96892642 GATTCCTGCCAGGCTCACTCTGG - Intronic
934934095 2:98452118-98452140 GTCTCCTTCCCTGCTCCTGCTGG - Intronic
935357919 2:102221654-102221676 GACTCCTGCCCTACACTTTAAGG + Intronic
935714580 2:105928765-105928787 GACACCAGCCCTGCTCAGGCAGG + Intergenic
935768433 2:106392938-106392960 CACTCCTGCCCTTCACACTCAGG - Intronic
935911669 2:107902986-107903008 CACTCCTGCCCTTCACACTCAGG + Intergenic
937668588 2:124515257-124515279 GAATGCTGCCCTGCTGATACTGG + Intronic
937685465 2:124691449-124691471 ATCTCCTGCCCTGCTGTTTCTGG - Intronic
941299923 2:163788231-163788253 TAATCCTGCCTTGGTCATTCAGG + Intergenic
945244086 2:207702405-207702427 GACTCCTCCCCTGATACTTCTGG + Intergenic
948061286 2:235044798-235044820 GACTCCTGCCCCACTCCTGCCGG - Intronic
1168813292 20:720153-720175 GCCTCCCTCCCTGCCCATTCAGG - Intergenic
1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG + Intronic
1175978051 20:62723425-62723447 GGCTCCTGACCAGCACATTCCGG - Intronic
1177598579 21:23280654-23280676 GACTCCTAGCCTTCACATTCTGG + Intergenic
1179842320 21:44085145-44085167 TAATCCTGCCCTGGTCATTCTGG + Intronic
1181500771 22:23314407-23314429 GACTCCAGCCCTGGTACTTCTGG - Intronic
1184839458 22:47043989-47044011 GAGCCCTGCCCTGCTCAGACAGG - Intronic
950387538 3:12672055-12672077 CACTCCTTCCCTTCTCAGTCTGG - Intergenic
951117878 3:18886319-18886341 GAGTCCTGCTATGCTCAATCTGG + Intergenic
951437361 3:22680152-22680174 AACCCCTGCCCTGTCCATTCAGG + Intergenic
952810843 3:37401235-37401257 GAGACCTGCTGTGCTCATTCTGG + Intronic
954139682 3:48598484-48598506 GATTCCTGCCCTGCTTGTCCAGG + Intergenic
955985739 3:64572561-64572583 TTCTCCAGCCCTTCTCATTCAGG - Intronic
956854728 3:73264633-73264655 GACTCCTCCCCAACTCATTCTGG + Intergenic
961174344 3:124821516-124821538 CAGTCCTGCCCTGGTCATGCAGG + Intronic
961571667 3:127803668-127803690 GACTCATGCTCTGCACACTCAGG - Intronic
961813684 3:129536536-129536558 GCCTCCTGCCCTCCTACTTCAGG - Intergenic
962957355 3:140278481-140278503 AACTCCAGCCCTCCTCCTTCTGG + Intronic
963756472 3:149239717-149239739 TAATCCTGCCCTGGTCTTTCTGG - Intergenic
964816943 3:160727739-160727761 GACTCCTTCCCTCCTGCTTCAGG - Intergenic
964873246 3:161336456-161336478 GTCTCCTCCCCGGCTCATTTAGG - Intergenic
969008920 4:4044819-4044841 GACCCTTGCCCTGCTCAACCAGG - Intergenic
969466046 4:7357068-7357090 GTCTCCTTCCCTGCTCACTACGG + Intronic
969660166 4:8522802-8522824 AGCTCCTGCCCTGCTCCCTCCGG - Intergenic
972532727 4:39976363-39976385 TACTGCTACCCTGCTCAGTCTGG - Intronic
975280666 4:72558469-72558491 GACTCCTACCCTGATAATCCAGG + Intronic
975402020 4:73949585-73949607 GACTGTTGCCCTGCTCAACCAGG - Intergenic
977905036 4:102467598-102467620 AACTTCTGCCCCTCTCATTCTGG + Intergenic
978428862 4:108611327-108611349 GACTACATCCCTGCTAATTCTGG + Intergenic
979787829 4:124738938-124738960 GACTTTTGCCTTGCTCGTTCTGG - Intergenic
980841620 4:138268289-138268311 GACGCCTTCCCTGCCCATCCAGG + Intergenic
983323694 4:166227097-166227119 GACTCCTGCCCCGCCAACTCAGG - Intergenic
983813778 4:172097426-172097448 GACTCCTGCCTTCCTCATAATGG - Intronic
987395837 5:17422574-17422596 GGCTCCTTCCCTGTTAATTCAGG + Intergenic
992481831 5:77159052-77159074 GACTCCTGCCCTACTCTATGTGG + Intergenic
997354423 5:133253299-133253321 GTGGCCTGCCCTGCTCACTCGGG - Intronic
999088400 5:148913272-148913294 CACTCCTGCCTGACTCATTCAGG - Intergenic
999183839 5:149690728-149690750 GAGCCCTGCCCTACTCACTCAGG + Intergenic
999432522 5:151536512-151536534 GATTCCTGCCCTGCTGCTGCAGG - Intronic
1000004742 5:157172944-157172966 GAATCCTTCCCTGCTCACACAGG + Intronic
1001521838 5:172399955-172399977 GACTGTTGCCCTGCTCAACCAGG + Intronic
1002194437 5:177494589-177494611 GCTTCCTGCCCTCCTCACTCTGG - Intronic
1003037901 6:2661317-2661339 GACTCCTGCCTTGTGCACTCAGG - Intergenic
1003115460 6:3280981-3281003 TTCTCCTGCCCTGCCCACTCCGG - Intronic
1005971791 6:30767533-30767555 GACTTATGTGCTGCTCATTCTGG + Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006185856 6:32181391-32181413 GACAGCCGCCCTGCTCATTGGGG - Exonic
1013472543 6:110477560-110477582 GACTCCATCCCTGATGATTCAGG + Intergenic
1017358010 6:153532852-153532874 GACTCCTCCCTAACTCATTCTGG - Intergenic
1018149834 6:160927220-160927242 TACTCCTCACCTGCTTATTCCGG - Intergenic
1019964362 7:4486558-4486580 GATTCCCGCCCTGCTCACACCGG + Intergenic
1020179879 7:5913928-5913950 GAATGAGGCCCTGCTCATTCTGG + Intronic
1020303056 7:6810956-6810978 GAATGAGGCCCTGCTCATTCTGG - Intronic
1024787529 7:52925556-52925578 GCCTCCTGCCCTGCTCCTCTGGG - Intergenic
1024868917 7:53938902-53938924 GTCTCCTGTCCTGTTCATTCTGG - Intergenic
1024984008 7:55180470-55180492 ATCTGCTGCCCTGCTAATTCCGG - Intronic
1025953516 7:66164844-66164866 GGCTCCTGCCCTGCTTTTTCTGG + Intergenic
1026137750 7:67678325-67678347 GACTCCTGCCCATTTCAGTCTGG - Intergenic
1028234838 7:88347878-88347900 GACTCTTGCCCAGCTCAATGAGG + Intergenic
1028234951 7:88349305-88349327 GACTCTTGCCCAGCTCAGTGAGG + Intergenic
1031639585 7:124145285-124145307 TTCTCCTGCCCTGCTCATACTGG + Intergenic
1031734166 7:125335614-125335636 GACACCTGCACTGCTTGTTCTGG - Intergenic
1034489820 7:151387244-151387266 GCCTCCTGCCCTGGTCACCCAGG - Intronic
1035586517 8:779296-779318 GTCTTCTGCCTTGCTCATGCTGG + Intergenic
1036558761 8:9883994-9884016 GAATCATACCCTGCTCAGTCTGG - Intergenic
1037516708 8:19639045-19639067 GACTCCTCCCCTGCCTCTTCAGG + Intronic
1037778243 8:21849598-21849620 GAGTCCTGCCCTGCCCCTCCCGG - Intergenic
1037948949 8:23006596-23006618 CACTCCTGCCCTGCTCTGTCTGG - Intronic
1039777695 8:40752846-40752868 GACACCAGCCGTGCTCATGCTGG + Intronic
1042065023 8:64865080-64865102 CACTCCTTCCCTTCCCATTCTGG + Intergenic
1044925958 8:97209012-97209034 GACTGCTGCCCACCTCACTCAGG + Intergenic
1048612305 8:136036115-136036137 AACTCATGCCCTGCTCTTTGGGG - Intergenic
1049045064 8:140143283-140143305 GATCTGTGCCCTGCTCATTCAGG + Intronic
1049207197 8:141369101-141369123 GGCTCCAGCCCTGCCCAATCTGG - Intergenic
1050397151 9:5211020-5211042 ACCTCCTGCCCTGCTGACTCTGG - Intergenic
1050399390 9:5235161-5235183 ACCTCCTGCCCTGCTGACTCTGG - Exonic
1050431975 9:5571453-5571475 GTCTCCTGCCCTGCTCTCTGTGG - Intergenic
1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG + Intergenic
1058125227 9:101185216-101185238 GGCTCCTGACCTGGTCATTTTGG + Intronic
1058486149 9:105445252-105445274 CTCTCCTGCCCAGCTCATCCTGG - Intergenic
1058720869 9:107762415-107762437 GATTCCTGCACTGCTCATTTAGG - Intergenic
1059506308 9:114802848-114802870 GCCTCCTTCCCTGTGCATTCAGG - Intronic
1062285618 9:135771303-135771325 GTCTCCTGCCCTGCCCGGTCTGG - Intronic
1062418049 9:136463370-136463392 GGATCCCGCCCTGCTCCTTCGGG + Intronic
1062499758 9:136847384-136847406 GAACCCTGCCCTGCCCACTCAGG + Exonic
1187084103 X:16023778-16023800 GACTTCTTCCAAGCTCATTCAGG - Intergenic
1188952984 X:36399636-36399658 CACTCCTGCCCTCCTAATTAGGG - Intergenic
1190740786 X:53287595-53287617 GACTCCTGCCCTGAGCCTTACGG - Intronic
1190984780 X:55490240-55490262 GCTTCCTCCCCTGCACATTCTGG - Intergenic
1191125264 X:56947505-56947527 GACCGCTGCCCTGCTCAACCAGG + Intergenic
1191607353 X:63077400-63077422 CTCTCCTGTCCTGCTCATGCTGG - Intergenic
1195217738 X:102716472-102716494 GATTCCTGCTCTTCTCCTTCTGG - Exonic
1197048658 X:122031283-122031305 CACTCCTACCCTCCTCCTTCTGG + Intergenic