ID: 1173273952

View in Genome Browser
Species Human (GRCh38)
Location 20:41562268-41562290
Sequence GTCAACTAACCAATAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173273952 Original CRISPR GTCAACTAACCAATAATGGA AGG Intronic
906539328 1:46572964-46572986 GCCAACAAAACAATAATGAATGG - Intronic
906823624 1:48955330-48955352 GTCAACAAACACATAAAGGAAGG - Intronic
911197286 1:95007382-95007404 GTCATCTAACCAAGACTGGCGGG + Intronic
917627506 1:176861259-176861281 GTTAACTAAAAAATAATGAACGG + Exonic
917634767 1:176924509-176924531 GTCAAGTAACAAATAAATGAAGG - Intronic
917721659 1:177791791-177791813 GTCAACCATCAAATAAGGGAGGG + Intergenic
920317464 1:205088096-205088118 GACAATGAACCAATATTGGAGGG + Exonic
920580457 1:207102270-207102292 GTCAACTAATCAAACATTGAAGG + Intergenic
921038920 1:211410557-211410579 GTCAACTGACCATAAATGTAAGG - Intergenic
1063832670 10:9972982-9973004 GTGGACTAATCAATAATGGTGGG + Intergenic
1064374444 10:14782962-14782984 GTCACCTAACCAAGACAGGAGGG + Intergenic
1071318628 10:84428775-84428797 CTCAACTATCCATGAATGGAAGG - Intronic
1074463557 10:113661647-113661669 GTCAAATAACCAGTTATCGACGG - Intronic
1080558647 11:33440809-33440831 ATCCACTATCCAAAAATGGATGG - Intergenic
1081783297 11:45728469-45728491 GACAACAAACCAATAAAAGAAGG - Intergenic
1088868626 11:113873005-113873027 TACAACTGACCAATAAGGGAAGG + Intronic
1089855641 11:121542087-121542109 TTCAGCTAAAAAATAATGGATGG - Intronic
1092330819 12:7585418-7585440 GACAACTACACAATAATGGTGGG + Intergenic
1093631486 12:21414744-21414766 TTTAACTTACCAATAATGAAAGG + Intronic
1097019552 12:56010178-56010200 GTCAACAGACCAATAAAGAAAGG - Intronic
1098610474 12:72451422-72451444 GTCAATTGACCAAAAATGCAAGG + Intronic
1099167020 12:79319408-79319430 GCCAAGTAGCTAATAATGGAAGG + Intronic
1099964130 12:89427238-89427260 ATCAACTGACCATAAATGGAAGG - Intronic
1110486485 13:76050798-76050820 TTCAAATTACCAAGAATGGAAGG + Intergenic
1111161659 13:84402616-84402638 GGCCACAAACCAAGAATGGAAGG - Intergenic
1114232249 14:20793658-20793680 GTCAGCACACTAATAATGGAAGG - Intergenic
1128954737 15:71927915-71927937 GTCAACTAACCATAAATGTACGG + Intronic
1131027894 15:89160644-89160666 CTCAGCTAAGCCATAATGGATGG - Intronic
1144603573 17:16642366-16642388 ATCAACTGACCATTAATGTAGGG - Intronic
1149120889 17:53162612-53162634 ATTAACAAACCAATAGTGGAGGG - Intergenic
1149793407 17:59499003-59499025 GTCAACTGGCTGATAATGGATGG + Intergenic
1153522891 18:5968747-5968769 GTAAAATAACCAATATTGTAAGG + Intronic
1156199423 18:34813121-34813143 GTAAACTAACCTTTAATGTATGG - Intronic
1160655754 19:268033-268055 TTCATATCACCAATAATGGATGG + Intergenic
1161762464 19:6184185-6184207 GCCAACAAACCAATAATAAAGGG - Intronic
930919624 2:56736549-56736571 GTCAAGAAACTAAAAATGGAAGG - Intergenic
939141850 2:138363432-138363454 GCCAAATAAACAATAATGAAAGG + Intergenic
939480937 2:142746353-142746375 GTGAATTAAACAATAATAGATGG - Intergenic
939954656 2:148517493-148517515 GCCAAATATCCAATAATGCATGG - Intronic
941382426 2:164811259-164811281 GAGAACTAAGCAATAATGCATGG + Intronic
943104423 2:183527040-183527062 GTAAAATAGCCAATAATGCATGG - Intergenic
946581866 2:221137703-221137725 GCCATCTAACAAATATTGGATGG + Intergenic
948137885 2:235650479-235650501 CTCAACTAACATATAATGGATGG - Intronic
948190419 2:236053936-236053958 GTGAACTTACAAATAATGGGGGG - Intronic
1169173432 20:3486186-3486208 TTCAAATAAACAAAAATGGAAGG + Intronic
1172556055 20:35842413-35842435 GTCAAATCACAAATTATGGAGGG - Intronic
1173273952 20:41562268-41562290 GTCAACTAACCAATAATGGAAGG + Intronic
1178227769 21:30742771-30742793 ATCAACAAATCAATAATGGAAGG - Intergenic
1184197788 22:42942706-42942728 GTCAACTGACCATAAATGTAGGG + Intronic
949174335 3:1040384-1040406 CTCAACAAACTTATAATGGAAGG - Intergenic
949977158 3:9471438-9471460 GTCAGCCAACCAACAATTGAGGG + Intronic
951644510 3:24873282-24873304 GTCATATAACCATTAATGAAAGG - Intergenic
957799500 3:85057785-85057807 GTGAACTATTCAATAAAGGAGGG - Intronic
961597668 3:128031663-128031685 GTCAACCAACCATTTATGCATGG + Intergenic
966646193 3:182248465-182248487 GTCATGGAACCAATAATTGATGG + Intergenic
967190340 3:186979261-186979283 GTCAACTAATCAATAACGCTAGG - Intronic
968814811 4:2816614-2816636 GTCAACAAACCAGGAATAGAAGG - Intronic
970814146 4:20134044-20134066 CTCAACAAACCATTAATAGAAGG + Intergenic
972987186 4:44778799-44778821 AACAACCAACCAATAATGCATGG - Intergenic
973942985 4:55928856-55928878 GTCAAGTGAGCAAAAATGGAAGG + Intergenic
974941122 4:68469392-68469414 GTCAACTAACCATTGATAAATGG + Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
978982629 4:114968013-114968035 GTCAAGCAACCATCAATGGAAGG + Intronic
983016533 4:162620267-162620289 TTCACATAACCAATGATGGAAGG - Intergenic
989345916 5:40429216-40429238 GCCAAATAACCAAGAGTGGAAGG - Intergenic
990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG + Intronic
993628933 5:90260144-90260166 GTCATCTAACCAAAAATTAAGGG + Intergenic
993776267 5:92001369-92001391 GTCAATTAACCCCTAAAGGAAGG + Intergenic
1000215681 5:159153709-159153731 GTCAACCAACCAAAAAAGGTTGG + Intergenic
1001227806 5:169960581-169960603 TTAAAATGACCAATAATGGAGGG + Intronic
1007077348 6:39076241-39076263 GTCAACACACCAATAAGGGAAGG - Intronic
1007304492 6:40893428-40893450 GCCAACCAACCAATCAGGGAAGG + Intergenic
1016723862 6:147336355-147336377 GACAATTAACCCATAATAGATGG - Intronic
1021617122 7:22513538-22513560 CTCAGCAAACTAATAATGGAAGG - Intronic
1022926716 7:35062990-35063012 CTCAGCAAACTAATAATGGAAGG - Intergenic
1026254547 7:68699288-68699310 GTCAATTTGCCAGTAATGGATGG - Intergenic
1027947763 7:84771094-84771116 TTCAACTAACAATTACTGGATGG + Intergenic
1028375554 7:90142561-90142583 CTCAGCAAACTAATAATGGAAGG + Intergenic
1030994973 7:116349199-116349221 GACACCTAACCAATCCTGGATGG - Intronic
1041389483 8:57336130-57336152 ATCAACTAATCGATGATGGATGG - Intergenic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1042880642 8:73484924-73484946 GTCAACTAATTAATAAGGTATGG - Intronic
1043600754 8:81934985-81935007 ATAAACTAACAATTAATGGAGGG + Intergenic
1044491088 8:92815755-92815777 GGCAACTGACCAAGGATGGAGGG + Intergenic
1047514919 8:125545572-125545594 GTCAACAAACCAATAAATGATGG - Intergenic
1051019676 9:12527489-12527511 TTCAACAAACCAGTAATAGAGGG - Intergenic
1059138677 9:111831620-111831642 GTCACCTAACTAATAAAGGGTGG - Intergenic
1061827511 9:133269690-133269712 GTCAATTCACCAGTAATGGTTGG + Intronic
1186259322 X:7759567-7759589 GTCCAATAACCAATAAAAGATGG + Intergenic
1191162499 X:57346165-57346187 GAAAACTAACCAATAAATGAAGG - Intronic
1194301436 X:92191596-92191618 GTCAATAACCCAATAATGAACGG - Intronic
1198054644 X:132981653-132981675 GACATTTCACCAATAATGGACGG + Intergenic
1199219697 X:145303885-145303907 GGCAACCACCCAATAATAGAGGG - Intergenic