ID: 1173274354

View in Genome Browser
Species Human (GRCh38)
Location 20:41566577-41566599
Sequence TCCTCTACTTGGGCATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173274354 Original CRISPR TCCTCTACTTGGGCATAAGA AGG (reversed) Intronic
900202123 1:1413315-1413337 CCCGCCACTTGGGCAGAAGATGG - Intergenic
900738615 1:4316621-4316643 TTCTCTACTTGGCCCTAAGTTGG + Intergenic
904297374 1:29528859-29528881 GCCTCTACTTGGGCTTTTGATGG + Intergenic
904394074 1:30206268-30206290 TCCTATACTTGTGGATAAGGTGG - Intergenic
906724685 1:48035693-48035715 TCCTCTCCTTGTGTAAAAGAGGG + Intergenic
909489933 1:76214968-76214990 TCCTCAAATTGGGCATAATAGGG + Intronic
912029696 1:105224956-105224978 TCCACTACTTGGATAGAAGAGGG - Intergenic
916390861 1:164329412-164329434 TACTCTACTTGGCCATTATAAGG + Intergenic
917219786 1:172716665-172716687 TCCTCCACTTGTGCATAGGCAGG + Intergenic
923729994 1:236540937-236540959 TCCTTTGCATGGGCATAAAATGG + Intronic
924484032 1:244462168-244462190 TCCTCTCCTCTGGCAAAAGAAGG - Intronic
1064362078 10:14675211-14675233 TCCTCTCCATGGGAATAAGCTGG + Intronic
1066505647 10:36039594-36039616 TTCTCTTCTTGTGCATAAGGGGG + Intergenic
1068671426 10:59727517-59727539 CCTGCTACTTGGGCACAAGATGG - Intronic
1070658807 10:78290203-78290225 TGCTCTTCCTGGGAATAAGAGGG - Intergenic
1071282603 10:84116112-84116134 CCTGCTACTTGGGCACAAGATGG + Intergenic
1072199875 10:93148979-93149001 TCCTCCACTTGGGTATAAGATGG + Intergenic
1072485299 10:95848872-95848894 TCCTCTACTTGGGTAAAATCAGG + Intronic
1074055857 10:109922802-109922824 GGCTCTCCTTGGGCATAGGAGGG - Intronic
1074971673 10:118544262-118544284 TCCTCAACATGGCCAGAAGATGG - Intergenic
1075756600 10:124817260-124817282 TCCTTTAGTTGGTCATAATATGG - Intronic
1078329035 11:10403482-10403504 GTCTCTACTTGGACAAAAGAGGG + Intronic
1081538165 11:44010521-44010543 TTATCCACTTGGGCATGAGAGGG - Intergenic
1085240118 11:75046072-75046094 CCTGCTACTTAGGCATAAGATGG + Intergenic
1085321632 11:75577793-75577815 TCCTCTTCTGGAGCATAATATGG + Intergenic
1090861951 11:130661805-130661827 TCTTCTACTGGGGCATAACTGGG - Intergenic
1091018504 11:132076981-132077003 TCCTCTTCTAGGGAATATGAAGG - Intronic
1097902809 12:64890152-64890174 TCCTCTTCTTTGAGATAAGAAGG + Intergenic
1098602763 12:72352097-72352119 TCCTCTGCTTAGTCATAACAGGG + Intronic
1098749023 12:74271976-74271998 CCTGCTACTTGGGCACAAGATGG + Intergenic
1105695948 13:22888760-22888782 CCCCCCACTTGGGCACAAGATGG + Intergenic
1106542047 13:30698852-30698874 TCCTCAACTTTGGCAAAATAAGG - Intergenic
1106766123 13:32915626-32915648 TCCTAAAGTTGGGCAGAAGAGGG + Intergenic
1111548123 13:89771003-89771025 TCCTCTACTTTTGCAAAAAATGG + Intergenic
1112105155 13:96231983-96232005 TTGTCTGCTTGGGTATAAGAGGG + Intronic
1116240681 14:42338804-42338826 CCTGCTACTTGGGCACAAGATGG - Intergenic
1119384030 14:74246029-74246051 TCCCCTACTTGGGCAGGAGTAGG + Intronic
1122032270 14:98921160-98921182 TACTCTACATGGTCATAAAATGG + Intergenic
1202847274 14_GL000009v2_random:191060-191082 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
1202916739 14_GL000194v1_random:181622-181644 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
1202876056 14_KI270722v1_random:1575-1597 TCTTCCTCTTGGGAATAAGAAGG - Intergenic
1135206308 16:20487342-20487364 TCTTCTTCTAGGGTATAAGAAGG - Exonic
1145414715 17:22704872-22704894 TTCTCTGCCTGGGCAGAAGATGG + Intergenic
1146764542 17:35507292-35507314 CCTGCTACTTGGGCACAAGATGG + Intronic
1150849537 17:68691449-68691471 TGCTCTTCATGGTCATAAGATGG - Intergenic
1157943005 18:51949730-51949752 TCCTCTAGCCGGGCCTAAGAAGG + Intergenic
1158292474 18:55956906-55956928 CCGGCTACTTGGGCACAAGATGG + Intergenic
1165074212 19:33271896-33271918 TCCTCCACTTGGGCTGGAGATGG - Intergenic
1167581687 19:50348077-50348099 CCCGCCACTTGGGCATAAGATGG - Intronic
1202674606 1_KI270710v1_random:31235-31257 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
926491070 2:13527012-13527034 CCTGCTACTTGGGCACAAGACGG - Intergenic
931966702 2:67543395-67543417 TCCAGTACTTGGGCTTATGAGGG + Intergenic
941028650 2:160486593-160486615 TCCTCTACTTGGCCTCAATATGG - Intronic
941042448 2:160637726-160637748 TCCTCAACTTGAGAATAGGATGG + Intergenic
943858225 2:192827024-192827046 TGCTCTACTTGTGAATAATAAGG + Intergenic
946324774 2:218979744-218979766 ACCTCTTCTTGGGCACAGGAAGG - Intergenic
946467961 2:219929377-219929399 ACCTATACATGGGGATAAGATGG + Intergenic
947287741 2:228535865-228535887 TCTTCTACTTGGCCTAAAGATGG - Intergenic
1173274354 20:41566577-41566599 TCCTCTACTTGGGCATAAGAAGG - Intronic
1173963400 20:47092360-47092382 TCCTCTATTTGGGGAAAGGATGG - Intronic
1174751723 20:53117813-53117835 TCCACTGCTTGGCCAAAAGATGG - Intronic
1174807076 20:53613671-53613693 TTCTCTTCTGGGGCCTAAGATGG + Intergenic
1175769012 20:61611213-61611235 TCCTCTCCCTGGGGATCAGAGGG + Intronic
1176637328 21:9258949-9258971 TCTTCCTCTTGGGAATAAGAAGG - Intergenic
1177965200 21:27718998-27719020 TTCTTTGCTTGGGCATAACATGG - Intergenic
1178448095 21:32663688-32663710 CCTGCTACTTGGGCACAAGATGG + Intronic
1178925876 21:36774543-36774565 TCCTCCTCTTGGGGATAAGGAGG + Intronic
1179149394 21:38797006-38797028 TCCTCTACTGGGGCTTCAGAGGG - Intergenic
1180197996 21:46208830-46208852 TCCTCTGCTTGAGCCCAAGATGG + Intronic
1180732612 22:17993506-17993528 TCCACAACTTGGGAATCAGAAGG + Intronic
1181517356 22:23422828-23422850 TCCACAACTTGGGAATCAGAAGG + Intergenic
1184345322 22:43909452-43909474 TCCCCTCCTTGGGGAAAAGATGG + Intergenic
949386504 3:3508398-3508420 TCCTACACTTGGGCTTAAGAAGG + Intergenic
949677224 3:6469571-6469593 TCCTTTATTTGGGCTTAGGAGGG - Intergenic
951248173 3:20365024-20365046 CCTGCTACTTGGGCACAAGATGG - Intergenic
952257411 3:31707278-31707300 TTATTTACTTGGGCATAAGATGG - Intronic
952596191 3:35020917-35020939 TGCTGTACTTGAGAATAAGAAGG - Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
954921843 3:54198131-54198153 TTCTTTACTTGTGCATAACAAGG + Intronic
959656129 3:108807337-108807359 TCCTCCTCTTGGTTATAAGAAGG + Intergenic
962096383 3:132297125-132297147 CCTACCACTTGGGCATAAGATGG - Intergenic
964522015 3:157580277-157580299 GCTGCTACTTGGGCACAAGATGG - Intronic
964924396 3:161938035-161938057 CCTGCTACTTGGGCACAAGACGG + Intergenic
1202749566 3_GL000221v1_random:146070-146092 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
972028202 4:34414403-34414425 TCCTGCATTTGGCCATAAGATGG - Intergenic
972077832 4:35108147-35108169 CCCACCACTTGGGCACAAGATGG + Intergenic
975890070 4:79017026-79017048 TTCTCTATGTGGGCCTAAGAGGG - Intergenic
976969656 4:91090089-91090111 CCCACCACTTGGGCACAAGATGG - Intronic
977390221 4:96399654-96399676 CCCTCTACTTGATCTTAAGAGGG + Intergenic
983883037 4:172954325-172954347 TCGCCTACTTGGGCTTAAGATGG - Intronic
984998802 4:185464458-185464480 GCCTCTTCTTGGGAATAAAATGG + Intronic
1202752220 4_GL000008v2_random:17369-17391 TCTTCCTCTTGGGAATAAGAAGG - Intergenic
985668698 5:1195425-1195447 TTCCCCACTTGGACATAAGAGGG - Intergenic
989557945 5:42818706-42818728 CCCACCACTTGGGCACAAGATGG + Intronic
990266219 5:54079486-54079508 TCCTATACTTGAAAATAAGAGGG - Intronic
990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG + Intergenic
991675795 5:69088894-69088916 CCTGCTACTTGGGCACAAGATGG - Intergenic
992222728 5:74588778-74588800 TTTTCTCCTTGGGCTTAAGAAGG + Intergenic
992953144 5:81880491-81880513 TCGTCTAATTGGGCACATGAGGG + Intergenic
993754990 5:91717531-91717553 ACCACTACTTGGCCATAAAAAGG + Intergenic
997523452 5:134537916-134537938 TCCTATTCTTGGGCATGAGTGGG + Intronic
999559201 5:152781688-152781710 TCCTCTACAATGGCAGAAGAAGG + Intergenic
1000246750 5:159454486-159454508 TACCCTACTTGGGCACAATAAGG + Intergenic
1001893110 5:175355919-175355941 AACTCTACTTGGGCCTAACAAGG + Intergenic
1002407774 5:179049606-179049628 CCCGCCACTTGGGCACAAGATGG - Intergenic
1004353504 6:14911736-14911758 TCCTCTCTTTGGGTATAGGAGGG - Intergenic
1005462310 6:26080695-26080717 CCTGCTACTTGGGCACAAGACGG + Intergenic
1008333968 6:50277493-50277515 TCCTCTTCTATGGCACAAGATGG - Intergenic
1009837375 6:69019798-69019820 TACTCTAATTGTCCATAAGAAGG - Intronic
1010519726 6:76818126-76818148 TCCTAGACTTGGGCAGAAAATGG + Intergenic
1011934550 6:92759070-92759092 TTCTATCCTTGTGCATAAGATGG - Intergenic
1013690871 6:112641290-112641312 TGCTCAAATTGGTCATAAGATGG - Intergenic
1015173922 6:130285748-130285770 TCCTTTAACTGGGAATAAGATGG - Intronic
1020943424 7:14569255-14569277 TCCTTTACCTGAGCATAATATGG - Intronic
1020999949 7:15316336-15316358 TCCTCTACTGTGGCAGAAGAGGG - Intronic
1021849064 7:24790323-24790345 CCTGCTACTTGGGCACAAGATGG - Intergenic
1022633032 7:32103461-32103483 TCTGCTACCTGGGCATAAGTGGG - Intronic
1023612520 7:41985395-41985417 TCTTCTACTTTGACATAAGATGG + Intronic
1029178919 7:98685368-98685390 TCCTCTACTTGGTCATGAATTGG + Intergenic
1030657394 7:112183258-112183280 TCCTCCATTTGGGAATAGGAGGG + Intronic
1031571077 7:123360421-123360443 TCCATTACTTAGGCATAATAAGG + Intergenic
1033165216 7:139034215-139034237 ACCTCCACTTGGCCAGAAGAGGG - Intronic
1035170433 7:157014402-157014424 TCCACTACTTGGGAAGGAGATGG + Intergenic
1038090046 8:24242273-24242295 CCTGCTACTTGGGCACAAGATGG + Intergenic
1040699540 8:50044506-50044528 TTCTCTACTGGGGCATATGAGGG + Intronic
1043320605 8:78981006-78981028 TCCTCTTCTTTGGCATCACAAGG + Intergenic
1049634373 8:143678992-143679014 CCTGCTACTTGGGCACAAGATGG + Intergenic
1061785944 9:133028627-133028649 TGCTCTCCTTGGGTTTAAGAAGG - Intergenic
1203718208 Un_KI270742v1:176162-176184 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
1203533009 Un_KI270743v1:2065-2087 TCTTCCTCTTGGGAATAAGAAGG - Intergenic
1186949250 X:14604797-14604819 TGGTCTACATGGGCATAAGATGG - Intronic
1188106366 X:26152214-26152236 GCCTCCACTTGGACAAAAGAGGG + Intergenic
1189578864 X:42384502-42384524 TGCTCTACAGGGGCATAAGGGGG + Intergenic
1190270661 X:48860722-48860744 CCTGCTACTTGGGCACAAGACGG + Intergenic
1190771615 X:53519384-53519406 CCTGCTACTTGGGCACAAGACGG + Intergenic
1191914972 X:66191736-66191758 TTCTCTCCTTTGGCAAAAGAGGG + Intronic
1192895044 X:75433615-75433637 TACACTACTTGGCCATAAAAAGG - Intronic
1193717718 X:84951408-84951430 CCTGCTACTTGGGCACAAGATGG + Intergenic
1194384764 X:93238579-93238601 CCTGCTACTTGGGCACAAGATGG + Intergenic
1195314214 X:103662139-103662161 TCCTCTTCTTGGTGATGAGATGG + Intergenic
1196343728 X:114627299-114627321 TCTTCTACTTGTGCCTATGAGGG + Intronic
1196459684 X:115917489-115917511 CCCGCTACTTGGGCACAAGATGG - Intergenic
1196771783 X:119301586-119301608 TCCTAGACTTGGGCTAAAGAAGG - Intergenic
1198160922 X:134007366-134007388 TCGTCTACTTGGGCGTGAAAGGG - Intergenic
1199932957 X:152543541-152543563 TCCACAATTTGGGAATAAGAGGG - Intergenic
1201172360 Y:11281010-11281032 TCTTCCTCTTGGGAATAAGAAGG + Intergenic
1201259772 Y:12147751-12147773 CCTGCTACTTGGGCACAAGATGG - Intergenic