ID: 1173275991

View in Genome Browser
Species Human (GRCh38)
Location 20:41583024-41583046
Sequence CTGGAGTCCCAGATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173275991 Original CRISPR CTGGAGTCCCAGATGGCAGA AGG Intronic
900919172 1:5659831-5659853 CTGGAGGATCCGATGGCAGATGG - Intergenic
901398646 1:9000940-9000962 CTGAAGCCCCAGATGTCAAAGGG + Intergenic
901678047 1:10898309-10898331 CAGGAGTCCCAGGGGTCAGAGGG + Intergenic
902077013 1:13795379-13795401 CTGAAGTCACAGATGGTAGGAGG + Intronic
904755252 1:32765390-32765412 CAGGGGTCCCAGCTGCCAGATGG - Intronic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
908207441 1:61865482-61865504 CGGGAGGCCGAGATGGGAGATGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
910983333 1:92980213-92980235 CTGTAGTCCCAGTTGCCCGAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
916281447 1:163055707-163055729 CAGGTGTCTCACATGGCAGAGGG + Intergenic
916501300 1:165389639-165389661 CTAGAGACCCAGAGGGCAAAGGG - Intergenic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
917246992 1:173014169-173014191 CTGCAGCCTCACATGGCAGAAGG - Intergenic
917730446 1:177870153-177870175 TTGGAGCCCCAGTTGGCAGGAGG + Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918402516 1:184177742-184177764 TTGGGGTCCCACATGGCAAAAGG + Intergenic
919138603 1:193542060-193542082 CATGACTTCCAGATGGCAGATGG + Intergenic
920397941 1:205660171-205660193 CTGGGGTCCCAGATGCCACTAGG + Intronic
921482532 1:215679374-215679396 CTGCAGTCCCAGCCCGCAGAAGG + Intronic
921581558 1:216901873-216901895 CTGGAGTCCCAGATGCTTGGGGG - Intronic
923283521 1:232467726-232467748 CTGGAGTGCCAGATGACATTTGG - Intronic
923387503 1:233479747-233479769 CTGGCCACCCAGAAGGCAGAGGG + Intergenic
923609234 1:235475118-235475140 CTGTAGTCCCAGCTACCAGAAGG - Intronic
924924946 1:248671355-248671377 AGGGAGTCCCCGCTGGCAGAAGG + Intergenic
1062798696 10:363366-363388 ATGGAGCCCCTGATGGCGGAGGG - Intronic
1064004210 10:11687516-11687538 CTGGAATTTCAGATGTCAGAAGG + Intergenic
1064444239 10:15379401-15379423 CTGGAGCACAAGATGGCACAGGG + Intergenic
1064673254 10:17737008-17737030 CTGGAGACCCAGCTTGCATACGG - Intergenic
1065841276 10:29703512-29703534 CTGGAGAACCAGCTGACAGAAGG - Intronic
1066687482 10:37994497-37994519 ATGGAGTCACAGATGGGAGTGGG + Intergenic
1067400767 10:45971871-45971893 CTGGAGTCCCTGAGACCAGAAGG + Intergenic
1073446238 10:103582239-103582261 CTGGAATCCCAGAGGGGTGAGGG + Intronic
1073636730 10:105206903-105206925 CTGGAATCTCAACTGGCAGATGG + Intronic
1074143251 10:110695484-110695506 CTGGAGTCCAAGACAGCAAAGGG - Intronic
1074850165 10:117433035-117433057 CTGTGGTCTCAGATGGCAGATGG + Intergenic
1075034287 10:119050202-119050224 CTGGAATCCCAGATTGCTCAGGG - Intronic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076656727 10:132029146-132029168 CTCATGTCCCAGATGGCAGGGGG + Intergenic
1076691411 10:132225493-132225515 CTGGGGTTCCAGATGGGAGCTGG - Intronic
1077537862 11:3133118-3133140 CTGGAGTGGCAGATGGCCGGGGG - Intronic
1077914895 11:6604649-6604671 CTGGAGTTCCATATGGCTGGAGG + Intronic
1078151988 11:8767151-8767173 GTGGACTCCCAACTGGCAGAGGG + Intronic
1078551779 11:12286126-12286148 CTCAAGGCCCAGCTGGCAGAGGG + Intronic
1080479269 11:32629204-32629226 CTGAAGTCCCAGAAAGTAGAGGG + Intronic
1080687148 11:34524969-34524991 CTGGAGTGGCAGCTGACAGACGG + Intergenic
1080744643 11:35097892-35097914 CTGGAGTAACACATGCCAGAGGG - Intergenic
1081577765 11:44329923-44329945 CTGGAGTCACAGCTGGCACTTGG - Intergenic
1081695149 11:45104597-45104619 CTGAGGTCCCAGGTGGGAGATGG - Intronic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1083262746 11:61532054-61532076 CTGGAACCCTACATGGCAGAAGG + Intronic
1084836940 11:71809147-71809169 CTGCAACACCAGATGGCAGAAGG - Intergenic
1086887725 11:92224507-92224529 CTAGAGCCCCAGAGGGCTGAGGG + Intergenic
1088263180 11:107964417-107964439 CTGTGGTCCCAGCTAGCAGAAGG - Intergenic
1088807278 11:113364133-113364155 CTGGAGACCCAGCTGACAGATGG + Intronic
1089611798 11:119673388-119673410 CTAGGGTCCCAGCTGGAAGAGGG - Intronic
1089943572 11:122444229-122444251 ATGGACTCACATATGGCAGATGG + Intergenic
1090864804 11:130690209-130690231 CTGGAGTCCCAGTTGGAAATGGG + Intronic
1090946413 11:131433387-131433409 TGGGAGTTCCAGATGGCAGCAGG - Intronic
1091266341 11:134274464-134274486 GGGGAGCCCCAGATGGCAAAAGG + Intronic
1091288938 11:134426252-134426274 CTGAAGCCCCACATGACAGAAGG - Intergenic
1092051769 12:5475992-5476014 ATGGAGGCCCTGATGGAAGAAGG + Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1096670300 12:53194445-53194467 AAGGAGCCCCAGGTGGCAGAGGG - Exonic
1096803019 12:54123947-54123969 CTGGATTCCCAGATGAGTGATGG - Intergenic
1097630758 12:62059193-62059215 CTGTAGTCCCAGCTATCAGAGGG + Intronic
1098243687 12:68493476-68493498 TTGCAGTCCCAGTTGTCAGAAGG + Intergenic
1099031500 12:77530948-77530970 CTGTAGTCCCAGATCTCAGGAGG + Intergenic
1099523955 12:83696598-83696620 CTGGAGTTCCAGATGGGCGTGGG - Intergenic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100287496 12:93181435-93181457 GGGGAGTCCCACAAGGCAGAAGG + Intergenic
1100853416 12:98737156-98737178 CTGGAGGCAGAGATGGCAGCTGG - Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1100998638 12:100331482-100331504 CTGTAGTCCCAGCTACCAGAGGG + Intronic
1101942632 12:109111235-109111257 CTGGGGTCTCAGCTGGCAGCCGG - Intergenic
1102740586 12:115203945-115203967 CTGGGGTCCCAGTTGGCAGTAGG - Intergenic
1103041090 12:117696188-117696210 CTGGAGTGGCAGGTGGCAGGTGG - Intronic
1103136714 12:118513783-118513805 CTTGAGCCACAGATGGCAAATGG - Intergenic
1103380711 12:120491997-120492019 CTACAGTCCCACATGGTAGATGG - Intronic
1103665281 12:122559231-122559253 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
1104706547 12:130951698-130951720 CTGAACTCCCCGATGGCTGATGG - Intergenic
1104866923 12:131961317-131961339 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104885472 12:132104685-132104707 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1105590991 13:21792620-21792642 CTGGAGTCACAAGTGACAGATGG - Intergenic
1108020904 13:46126901-46126923 CTGGAGTCCCAAATGTCATCAGG - Exonic
1108598885 13:51973574-51973596 CCGGAGTCCCCACTGGCAGAAGG + Intronic
1109384088 13:61604631-61604653 CTGTGTTCCCACATGGCAGAAGG - Intergenic
1110882614 13:80590740-80590762 CTGGTTTTGCAGATGGCAGAGGG - Intergenic
1112135444 13:96573648-96573670 CTGGAGTCCAAGTTGGCAGCAGG + Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1114551308 14:23534259-23534281 CTGGGGTCCCAGGTGGCTGTGGG + Exonic
1115217639 14:31028297-31028319 CTGGAGTCCCAGCTATCAGGAGG - Intronic
1115300196 14:31876881-31876903 CTGCATTCCCACATGGCAGAAGG + Intergenic
1116889013 14:50249437-50249459 CTGGAATCCAAGATGTAAGACGG - Intronic
1116962693 14:50982492-50982514 CTAGAGTCCTAGATGGAGGAGGG + Intronic
1117176045 14:53147868-53147890 ATGGAGTCCCAGGGGGTAGAAGG - Intronic
1117287817 14:54304270-54304292 CTGTAGTCTCATATGGCAGAAGG - Intergenic
1117708717 14:58500629-58500651 CGGGAGGCTCAGAGGGCAGAGGG + Intronic
1118257271 14:64215929-64215951 CTGGGGACCAAGATGGCAGAAGG - Intronic
1118913494 14:70081521-70081543 ATGGAGGCCCAGAGGGCAGTTGG - Intronic
1119528596 14:75342900-75342922 GTGCAGGCCCAGATGGCAGCAGG - Intergenic
1120775150 14:88426443-88426465 CTGGAGCCCTGTATGGCAGAAGG + Exonic
1121578769 14:95010652-95010674 CTTGAGTCCCAGGGGGAAGAAGG + Intergenic
1122141167 14:99663927-99663949 CTGGAGCTCCTGATGGCAAATGG + Intronic
1122983676 14:105202638-105202660 CTAGAGTCACAGGTGGCAGGTGG + Intergenic
1123777929 15:23598963-23598985 CTGGATTTCCAGCTTGCAGAAGG - Intronic
1124841273 15:33244376-33244398 CTGGGGTCCCAGGCTGCAGATGG + Intergenic
1129456178 15:75677174-75677196 CTGCAGTCCCAGCTGGCTGCAGG - Exonic
1129606291 15:77026682-77026704 CTGAAAGCCCAGCTGGCAGATGG - Intronic
1129859142 15:78846922-78846944 CTGGAGTTCCAGATGGGCGTGGG + Intronic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1130240308 15:82182133-82182155 CTGCAGTCCCAGCTGTCAGGAGG + Intronic
1132337617 15:101058589-101058611 CTGCTGCCCCAGATTGCAGAAGG + Intronic
1132524193 16:406217-406239 CTGAAGGCCCAGCTGGCAGAGGG - Intronic
1133233162 16:4375889-4375911 CTGGCGTCACAGGTGGGAGACGG + Intronic
1133505315 16:6406264-6406286 CATGAGTCCCAGATGACAGGAGG - Intronic
1133947132 16:10357949-10357971 CTGGAACCCCAGATTCCAGAAGG - Intronic
1134285674 16:12860162-12860184 CTGGATGCTCACATGGCAGAAGG - Intergenic
1134515888 16:14886587-14886609 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134703561 16:16285231-16285253 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134963982 16:18426883-18426905 ATGGAGTCTCAGATGACAGAGGG - Intronic
1134968269 16:18509419-18509441 ATGGAGTCTCAGATGACAGAGGG - Intronic
1135976965 16:27114913-27114935 CTGGAACCCCTGAAGGCAGAGGG + Intergenic
1137779054 16:51081614-51081636 CTAGAGTCCAAGATGGAAGCTGG - Intergenic
1137916667 16:52439206-52439228 CTGAAGACGCATATGGCAGACGG - Exonic
1138353005 16:56356461-56356483 CCGGAGCCCCAGGCGGCAGATGG - Intronic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139311616 16:66032679-66032701 CAGGACCCCCAGATGGCTGAGGG + Intergenic
1140770022 16:78195043-78195065 CTGGGGTCCCAGTTAGCAGAAGG - Intronic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1142025764 16:87812681-87812703 CTGGAATCCCAGGTTGCAAAGGG + Intergenic
1203143147 16_KI270728v1_random:1782105-1782127 GTGGATCCCCAGATGGAAGATGG + Intergenic
1143010164 17:3861852-3861874 CAGGAGACCAAGATGGCAGGTGG - Intronic
1143323238 17:6081270-6081292 CTGGAGTTCCACATGGCTCAAGG + Intronic
1143720421 17:8805386-8805408 ATGAAGTCCCAGGTGTCAGAGGG + Intronic
1145759518 17:27418366-27418388 CTGAAGTCCAACATGGCACAGGG - Intergenic
1146930208 17:36771672-36771694 CTTGAGTGCAAGATGGCAGCAGG + Intergenic
1147607402 17:41782035-41782057 CTGGATTCCCTGAGGGCAGGCGG - Intronic
1147672896 17:42186939-42186961 CTGTAGTCCCAGCTGCCAGGAGG - Intergenic
1148044753 17:44736534-44736556 CTGGAGTCCCAGAGGCCTGGTGG - Intronic
1149271422 17:54982656-54982678 CTGGAATCCCTGTTGGCTGAGGG + Intronic
1149412590 17:56424111-56424133 CTGGAGTCCCACAGGGTAGAAGG + Intronic
1149519789 17:57310058-57310080 CTGGAAGTCCAGGTGGCAGAGGG + Intronic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1151326865 17:73385066-73385088 GTGGAGTGGCAGATGGCTGAAGG + Intronic
1151434751 17:74088097-74088119 CTGGAGCCCTACATGGCAAAAGG - Intergenic
1151886140 17:76924310-76924332 ATGGGATGCCAGATGGCAGAGGG + Intronic
1152237582 17:79146653-79146675 CTGGACTCGCAGATGGCAGCTGG - Intronic
1152350494 17:79781627-79781649 ATAGAGTCCCACATGGTAGAAGG + Intronic
1153008867 18:519829-519851 GTGGAGGCCCAGGTGGCAGGTGG + Intergenic
1153918442 18:9766459-9766481 CTGGTGTCCCAGGTGCCTGATGG + Intronic
1155025299 18:21935340-21935362 CTGCAGTCCCACATGGAAGGGGG - Intergenic
1155150902 18:23122128-23122150 ATGGTGTCCCAGAGGGCAAAGGG + Intergenic
1157313067 18:46566610-46566632 CTGGTGCCCCAGCTGGCTGATGG - Intronic
1157347328 18:46851520-46851542 TTGGAGTCAAAGATGGGAGATGG + Intronic
1157753073 18:50195188-50195210 CCGGAGGCCCAGGTGGCAGCGGG - Intergenic
1158136162 18:54210690-54210712 GGGGTGTCACAGATGGCAGATGG + Intronic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1160385639 18:78494742-78494764 CTGGTGTCCCTGAAGGCAGATGG + Intergenic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1161540197 19:4846102-4846124 CTGTAGTCCCAGCTACCAGAAGG + Intronic
1162552893 19:11367687-11367709 CTCTAGTCTCACATGGCAGAAGG + Intergenic
1163555920 19:17992914-17992936 CGGGGTTCCCAGATGGCCGAGGG - Intronic
1164126532 19:22323534-22323556 CTTGGGTCCCAGCTGACAGATGG + Intergenic
1164590292 19:29503131-29503153 CTGGAGCCCCTGATGGGAAATGG + Intergenic
1164848554 19:31458876-31458898 CTGCAGTCCCAGCTGCCCGAAGG + Intergenic
1164882218 19:31741880-31741902 CAGGAGTCCCAGGTTGCAGAGGG - Intergenic
1165136790 19:33674662-33674684 CGGGAGGCACAGATGGCAGATGG + Intronic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166381515 19:42357521-42357543 CTGGAGTACCAGCTGGCAACCGG + Exonic
1166574605 19:43826054-43826076 ATGAAGTCCCAGATGGGAAACGG + Intronic
1166650706 19:44572257-44572279 CTGGCGCCTCAGGTGGCAGAGGG - Intergenic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167539106 19:50074169-50074191 CTGGAGTCCCAGCAGCCAGGAGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925675698 2:6358870-6358892 CTAGAATCCCAGAAGGCAAAGGG + Intergenic
925992056 2:9261763-9261785 GTGGTGTCCCAGGTGGGAGAGGG + Intronic
928402224 2:30987449-30987471 GTGGAGTGTGAGATGGCAGAGGG - Intronic
928421216 2:31138735-31138757 CTTGGGTCCCAGCTGGCAGCTGG - Intronic
929440774 2:41964472-41964494 CTGGGGTCCAAGATCCCAGAGGG + Intergenic
929668356 2:43851275-43851297 CTAGAGTCCTAGATGCCACAGGG - Intronic
930110480 2:47674842-47674864 TTAGAGGCCCAGATTGCAGAGGG + Intergenic
930744130 2:54863397-54863419 CTGTAGTCCCAGCTGCCAGGAGG + Intronic
931615082 2:64147557-64147579 TTGGAGTTCCAGATGAAAGATGG + Intergenic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932468871 2:71940921-71940943 GTTGTGTTCCAGATGGCAGAGGG - Intergenic
932839900 2:75072414-75072436 TTGGAGACCCAGATGTGAGAGGG + Intronic
933587717 2:84198181-84198203 CTGGGTTGCCAGATGGCAGTTGG + Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
933969469 2:87458515-87458537 ATGGATTCCCACAGGGCAGAGGG - Intergenic
936064309 2:109318997-109319019 CTGTAATCCCAGTTAGCAGAGGG - Intronic
936324317 2:111491979-111492001 ATGGATTCCCACAGGGCAGAGGG + Intergenic
936726196 2:115319846-115319868 CTGCATTCTCACATGGCAGAAGG + Intronic
937000898 2:118466672-118466694 ATGGAGTCCTTGCTGGCAGAGGG + Intergenic
937281813 2:120722457-120722479 CGCGAGTCCCGGATGGCGGATGG - Intergenic
938203147 2:129393597-129393619 CAGGAGTTCCAGATTGCAGTGGG + Intergenic
939538050 2:143457421-143457443 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
940525438 2:154808045-154808067 CTGGAGTGTCAAATGGAAGAGGG + Intronic
941359375 2:164532886-164532908 CTCGTTTCCCAGAGGGCAGAGGG - Intronic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
942626264 2:177903870-177903892 CTGGAGTTCCAGATGAAAGCAGG + Intronic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
943985688 2:194615111-194615133 CTGTAGTCCCAGCTGTCAGGAGG - Intergenic
944144094 2:196487190-196487212 CTGGAGTCCCAGCTACCAGGAGG + Intronic
944776999 2:202976830-202976852 CTGTAGTCCCAGCTGCCAGGAGG - Intronic
945137365 2:206642545-206642567 CTCTACTCCCAGATGGCACAAGG - Intergenic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946502405 2:220263507-220263529 CTGGCTTCCCAGCTGCCAGATGG + Intergenic
947605113 2:231481094-231481116 CTGTGGTCCCAGCTGGCTGATGG - Intronic
948276587 2:236713792-236713814 CTGCTGTCCCAGAAGGCAGCTGG - Intergenic
1169510854 20:6262236-6262258 CTGGCTCCCCAGCTGGCAGATGG + Intergenic
1169635795 20:7690045-7690067 CTGCAGTCTCACATGGTAGAAGG - Intergenic
1171793741 20:29550641-29550663 CTGGATTCCCAGATGAGTGATGG + Intergenic
1171854729 20:30333749-30333771 CTGGATTCCCAGATGAGTGATGG - Intergenic
1172117783 20:32582715-32582737 CGGGAAGCCCTGATGGCAGAGGG + Intronic
1172729144 20:37071015-37071037 CTGTAGTCCCAGCTGTCAGGAGG - Intronic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174212324 20:48889896-48889918 CTGGGCTCCCAGATAGGAGAAGG - Intergenic
1175156106 20:56972754-56972776 TTGGGGCCCCAGAAGGCAGAGGG + Intergenic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1179255637 21:39713078-39713100 CTTGGTTCACAGATGGCAGATGG - Intergenic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180113660 21:45681000-45681022 CTGCATTCTCACATGGCAGAAGG + Intronic
1180233533 21:46442563-46442585 CTGGAGTCCCACCTGGGCGAGGG - Exonic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181280185 22:21714165-21714187 CTTCAGTCCCAGATGTGAGAAGG - Intronic
1183474261 22:38027099-38027121 GTGGAGTGCGAGATGGCATAGGG + Intronic
1184159281 22:42688367-42688389 CTGGAATCCCCCAAGGCAGAGGG - Intergenic
1184497268 22:44849175-44849197 CTGCAGTGCCAGATGGCAACAGG - Intronic
1184857807 22:47156082-47156104 CTGTCCTCCCAGATGGCTGAAGG + Intronic
1184909281 22:47515711-47515733 CTGGAGTCCAAGATGACTGTGGG + Intergenic
1184981174 22:48096976-48096998 CTGCAGCTCCAGATGGCAGGGGG - Intergenic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
949927973 3:9057223-9057245 CTGGAGTCCCACATGAAAGGTGG - Intronic
950401731 3:12774215-12774237 CTGGACCCCCAGCTTGCAGATGG - Intergenic
950702184 3:14758221-14758243 CCGGACCCCCAGATGGCAGCAGG - Intronic
952906658 3:38143623-38143645 CAGGAGTCCCTGAGGGCACAGGG - Intergenic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
953552650 3:43916025-43916047 CTGTAGTCCCAGCTAGCAGGAGG - Intergenic
953563997 3:44015476-44015498 CTGGAGGCCCAGCTGGGAGGAGG - Intergenic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
954861826 3:53696677-53696699 CTGGATTCAAAGATGGGAGAAGG + Intronic
954980425 3:54740706-54740728 CAGAAGTCCCAGAAGGCAGTAGG + Intronic
955766385 3:62348487-62348509 CTGGAGTCCCAGCTTTCAGGAGG - Intergenic
956695516 3:71915964-71915986 CTGTAGTCCCAGCTACCAGAGGG - Intergenic
959329792 3:104989143-104989165 CTGGAGTCTAAAATGCCAGAGGG + Intergenic
959524671 3:107363300-107363322 CAGGAGTTCCAGACGGCAGGCGG + Intergenic
960399416 3:117177893-117177915 ATGGAGTGGAAGATGGCAGAGGG + Intergenic
961006656 3:123410129-123410151 GTGGAGGCCCTGAGGGCAGATGG - Intronic
962029935 3:131589171-131589193 CTGGCTTCCCAGCTTGCAGATGG - Intronic
962536436 3:136333439-136333461 CTGGACACCGAGATGGTAGAGGG + Intronic
963024884 3:140909844-140909866 CTGTAATCCCAGATGGCTGAGGG - Intergenic
963035117 3:141019353-141019375 GTCTAGGCCCAGATGGCAGACGG - Intergenic
963830192 3:149999565-149999587 TTAGAGTGGCAGATGGCAGATGG - Intronic
964124170 3:153218540-153218562 CTGTAGCCCCAGATGTGAGAGGG + Intergenic
965497239 3:169413506-169413528 CTGGAGTTCCAGATGCCACTTGG - Intronic
966903060 3:184500946-184500968 CTGCTGTGCCAGCTGGCAGATGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968689040 4:1980678-1980700 CTGGGGACCCTGATGGGAGAAGG - Exonic
968785913 4:2622339-2622361 CAGGAGTCCCCAAGGGCAGAGGG + Intronic
968940027 4:3632936-3632958 CTGGAGTCCCACGTCCCAGATGG - Intergenic
969172441 4:5375111-5375133 CTGGAGTTTCAGAAGCCAGATGG - Intronic
969705422 4:8788935-8788957 ATGGAGGCCCACATGCCAGAAGG + Intergenic
969778343 4:9376642-9376664 CTGCAACACCAGATGGCAGAAGG - Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
970792304 4:19873118-19873140 CTTGAGTCATATATGGCAGAAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972581593 4:40400068-40400090 CCGCAGTCCAGGATGGCAGAGGG + Intergenic
973047412 4:45551882-45551904 CTGGAGTACCGGAAGGCAGTTGG - Intergenic
974128983 4:57730089-57730111 CTGGAGTTCCAGGTGGGAGTGGG - Intergenic
976248443 4:83026634-83026656 CTGTAGTCCCAGCTAGCAGCTGG - Intergenic
978385577 4:108172833-108172855 CTCGCCTCCCAGCTGGCAGAAGG - Intergenic
983703297 4:170625099-170625121 CTGATGGCCGAGATGGCAGAGGG - Intergenic
984620206 4:181944191-181944213 CTGGGGCTCCAGCTGGCAGATGG - Intergenic
985010040 4:185573114-185573136 CTGTAGTCCCAGCTGACAGGAGG - Intergenic
985386643 4:189454602-189454624 CTGGAGGCCCAGCTGGCCTAGGG - Intergenic
986431752 5:7688202-7688224 GAGGAGTCCCTGATGGGAGAAGG - Intronic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990448356 5:55913848-55913870 CTCCAGTCTCAGATGGCAAATGG - Intronic
991532093 5:67626849-67626871 CTGCATTCTCACATGGCAGAAGG - Intergenic
991977594 5:72198426-72198448 CTGGAGTCCTGCATGTCAGAAGG - Exonic
992832184 5:80604449-80604471 CTGCATTCCGACATGGCAGAAGG - Intergenic
993748293 5:91630246-91630268 CTGGATCCTCACATGGCAGAGGG - Intergenic
994010318 5:94894767-94894789 CTGGAGTTGCAGCTGGAAGAGGG - Exonic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
996517872 5:124393790-124393812 CTGGAGGCTGAGATGGCAGTTGG - Intergenic
997997373 5:138597470-138597492 TTGGAGTCCCAGATAACAGCTGG - Intergenic
998527508 5:142856270-142856292 CTGGAGGGCCAGGTGGCAGTCGG + Intronic
998807786 5:145935700-145935722 CGGGAGTCACAGCTAGCAGAAGG - Intergenic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
1001231107 5:169989522-169989544 CTATGGTCCCAGAAGGCAGAGGG + Intronic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1005938339 6:30542154-30542176 CAGAAGCCCCAGATGTCAGAGGG - Exonic
1006323677 6:33336823-33336845 CTGGAGCCCCACATTTCAGAAGG - Intergenic
1006411315 6:33875546-33875568 CTGGCTTCCCAGAGGGCCGAGGG + Intergenic
1007429695 6:41769632-41769654 CTGGAGTCCTAGAAGCCAAAAGG - Intergenic
1007572755 6:42905047-42905069 ATGGAGTGTCAGAGGGCAGAGGG + Intergenic
1007655787 6:43450302-43450324 CTGGCGTTCCAGATGCAAGAGGG - Exonic
1008680230 6:53864213-53864235 GTGGAGACCCAGGAGGCAGAGGG - Intronic
1009236835 6:61133986-61134008 CTGGAGTTCCAGGTGCCACAGGG + Intergenic
1010623546 6:78106932-78106954 CTGGATTCTCATGTGGCAGAAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011574920 6:88786947-88786969 GTTGTGTCCCACATGGCAGAAGG - Intronic
1012479649 6:99652261-99652283 CAGGTGTCTCACATGGCAGAAGG - Intergenic
1012958850 6:105600866-105600888 CTTGAGTCCCAGAGTTCAGAAGG + Intergenic
1015069141 6:129068467-129068489 CTGTAGCCTCACATGGCAGAAGG + Intronic
1016017091 6:139197859-139197881 CTGGATTCTCACTTGGCAGAAGG + Intergenic
1016587539 6:145706998-145707020 CTGCAGCCTCACATGGCAGAGGG - Intronic
1017521643 6:155207985-155208007 TTGGAGCCCAAGATGCCAGATGG - Intronic
1017810036 6:157977913-157977935 CTGTAGCCCCAGATGCCTGATGG + Intergenic
1018049812 6:159999144-159999166 CTGGAGTGGGTGATGGCAGAGGG - Intronic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1023114911 7:36853286-36853308 CTGGAGTGCCAGAAGAGAGAGGG + Intergenic
1023705717 7:42939907-42939929 TTGGAGCCTCACATGGCAGAGGG - Intronic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG + Intronic
1024164570 7:46717772-46717794 CTGGAGTCTGAGATTGCAAAAGG - Intronic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1024797528 7:53036452-53036474 CAGAAGTCCCAGATGGCGGATGG - Exonic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026395693 7:69951676-69951698 CAGGATTCCAAGATGGCAGCTGG + Intronic
1026924743 7:74182862-74182884 CTCCACTTCCAGATGGCAGATGG - Intronic
1030803265 7:113880635-113880657 TTTGAGTACCAGTTGGCAGAGGG - Intronic
1031998959 7:128252345-128252367 CTGGAATCTCAGCAGGCAGAGGG - Intronic
1032079745 7:128852926-128852948 CTGGCGTCCCCGATCTCAGATGG - Exonic
1032124025 7:129178478-129178500 CTGTAGTCCCAGCTACCAGAAGG - Intergenic
1032434279 7:131887504-131887526 CTGGAGTCCCAGGTGACTAACGG - Intergenic
1034172792 7:149075783-149075805 CTGTAGTCCCAGCTGTCAGGAGG - Intronic
1034428272 7:151026400-151026422 ATGGAATCCCACATTGCAGAGGG + Intergenic
1035129826 7:156641106-156641128 CTGGGGCCCCTGATGGCAGCCGG - Intronic
1035274516 7:157739619-157739641 CAAGAGTCCCAGATGGCAGTTGG - Intronic
1035571295 8:674808-674830 CTGGACTCCAGGTTGGCAGAAGG + Intronic
1035597809 8:872916-872938 CTCAAGTCCCTGATGGCAAAAGG + Intergenic
1036275799 8:7350638-7350660 CTGAAACACCAGATGGCAGAAGG - Intergenic
1036345556 8:7959720-7959742 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036645085 8:10607754-10607776 GGGGAGGCCCAGAAGGCAGAAGG - Exonic
1036645178 8:10608126-10608148 GTGGAGACCCAGGAGGCAGAAGG - Exonic
1036840883 8:12120474-12120496 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036862690 8:12366724-12366746 CTGAAACACCAGATGGCAGAAGG + Intergenic
1037034908 8:14154245-14154267 CTGTAGTCCCAGCTAGCAGGAGG + Intronic
1037185685 8:16059797-16059819 TTTGAGTCCCAGATGGAAAATGG + Intergenic
1038174596 8:25168893-25168915 CTGGAGTCCAGTAGGGCAGAGGG - Intergenic
1038348040 8:26750151-26750173 CTGGAACCTCAGATAGCAGAAGG + Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1040013343 8:42680456-42680478 CTGGTATCCCACATGGCAGAGGG - Intergenic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041395382 8:57384804-57384826 CTGGAATCCCAGAGGAAAGAGGG + Intergenic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1042198584 8:66256788-66256810 CTGTAGTCCCAGCTGTCAGGAGG + Intergenic
1042482934 8:69324096-69324118 CTGGAGACCCAGGGGGCAGCTGG + Intergenic
1043020836 8:74997728-74997750 CTGGTGTCCCAGAAGCCAGGAGG + Intronic
1045471125 8:102513353-102513375 TTGGAGACCCATTTGGCAGAAGG - Intergenic
1046631872 8:116629616-116629638 GAGGAGTCCCAGAGGCCAGAAGG - Intergenic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1049499323 8:142953197-142953219 TTGGAGGCCAAGATGGCGGAGGG - Intergenic
1050338532 9:4613104-4613126 CTGTAGTCCCAGATACCAGGAGG + Intronic
1050759677 9:9052152-9052174 CTGTGCTCCCACATGGCAGAAGG + Intronic
1052075428 9:24135136-24135158 CTGGAGTTCCAGATGGGCGTGGG + Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1052338911 9:27346135-27346157 CTGCATTCTCACATGGCAGAAGG - Intronic
1052877081 9:33575377-33575399 CTGCAGCCCCAGATGGCACCTGG + Intergenic
1052932857 9:34069939-34069961 CTGGAGTCAGAGATGGCACTAGG - Intergenic
1053498924 9:38569017-38569039 CTGCAGCCCCAGATGGCACCTGG - Intronic
1053792553 9:41697030-41697052 CTGGATTCCCAGATGAGTGATGG - Intergenic
1054152621 9:61617790-61617812 CTGGATTCCCAGATGAGTGATGG + Intergenic
1054180966 9:61909051-61909073 CTGGATTCCCAGATGAGTGATGG - Intergenic
1054450726 9:65402342-65402364 CTGGAGTCCCACGTCCCAGATGG + Intergenic
1054656625 9:67672091-67672113 CTGGATTCCCAGATGAGTGATGG + Intergenic
1055223095 9:73962735-73962757 CTGGGTCTCCAGATGGCAGATGG - Intergenic
1057278118 9:93686969-93686991 CTGGAAGTCTAGATGGCAGAGGG + Intergenic
1057678371 9:97153509-97153531 CTGCAGCCCCAGATGGCACCTGG - Intergenic
1058683909 9:107464425-107464447 CTGTAGTCCCAGCTATCAGAAGG + Intergenic
1060348676 9:122838572-122838594 CTGGAGTCAGAGCTGGCACAGGG + Intergenic
1061238914 9:129358014-129358036 CTGGAATCCCAGATGGGTGGAGG - Intergenic
1061406719 9:130396302-130396324 CAGGAGCCCCAGGTGGGAGAGGG + Intronic
1062229907 9:135476238-135476260 CTGGAATCCCAGCTGTCAGGAGG - Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062512621 9:136915606-136915628 CTCGAGTCCCTGATGGAAGATGG - Intronic
1185521858 X:746253-746275 CTGGAGACCCACTTGGCAGCAGG + Intergenic
1186694325 X:12013637-12013659 CTGGATACCCAGGAGGCAGAGGG - Intergenic
1188567712 X:31545389-31545411 AAGGAATCCCAGAAGGCAGAAGG - Intronic
1190211782 X:48454565-48454587 CTGCATTCTCATATGGCAGAAGG - Intergenic
1190425210 X:50329212-50329234 CTGGAGTCCCACTAGGCAGTGGG - Intronic
1192032423 X:67528482-67528504 CTGTGGTCTCATATGGCAGAAGG + Intergenic
1193445793 X:81600125-81600147 CTGGAATGCCAGATGCCAGGTGG - Intergenic
1197765555 X:130057367-130057389 CTGGAGGCCCAGAGGCCAGGGGG - Exonic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1199235664 X:145489306-145489328 CTGGTTTCACTGATGGCAGAAGG + Intergenic
1199581259 X:149362652-149362674 CTGGACTTCCAGCTGACAGATGG + Intergenic
1199778215 X:151034214-151034236 CTGCATTCTCACATGGCAGAAGG - Intergenic
1199831617 X:151554290-151554312 CTGGAACCCCAGAGGTCAGAGGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic