ID: 1173277895

View in Genome Browser
Species Human (GRCh38)
Location 20:41600404-41600426
Sequence TACCCTACTCCGCTTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173277895_1173277905 7 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277905 20:41600434-41600456 GGGGGGGTCTTATCCAGGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 92
1173277895_1173277907 26 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277907 20:41600453-41600475 AGGGTCACAAGAGAACCTTATGG 0: 1
1: 1
2: 4
3: 26
4: 265
1173277895_1173277902 -9 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277902 20:41600418-41600440 AGTAGGGTAGAGTGAGGGGGGGG 0: 1
1: 0
2: 3
3: 52
4: 617
1173277895_1173277904 6 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277904 20:41600433-41600455 GGGGGGGGTCTTATCCAGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 119
1173277895_1173277901 -10 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277901 20:41600417-41600439 GAGTAGGGTAGAGTGAGGGGGGG 0: 1
1: 0
2: 4
3: 53
4: 630
1173277895_1173277903 2 Left 1173277895 20:41600404-41600426 CCAGAACTAAGCGGAGTAGGGTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1173277903 20:41600429-41600451 GTGAGGGGGGGGTCTTATCCAGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173277895 Original CRISPR TACCCTACTCCGCTTAGTTC TGG (reversed) Intronic
906346137 1:45015757-45015779 TACCCTACCCCATGTAGTTCTGG - Intergenic
922209423 1:223476200-223476222 TACCCTATTCCCCTTCCTTCAGG + Intergenic
1068303990 10:55179690-55179712 TACCCTATTCCTCTTGGTTGTGG + Intronic
1071601584 10:86961162-86961184 TGCCCTACTCCTCTTGGCTCTGG + Intronic
1075462345 10:122625365-122625387 TACCCTACTCCTCCTACTTCTGG - Intronic
1130400845 15:83551979-83552001 TATCCTACTAGGCTTTGTTCTGG + Intronic
1143303683 17:5929477-5929499 TACGCTACTCTGCTTTCTTCAGG - Intronic
1144343554 17:14330994-14331016 TACCCTCCTCCCCTTCTTTCTGG + Intronic
932676076 2:73782549-73782571 AACCCTATTCCGCCTAGGTCTGG - Intergenic
942556895 2:177181087-177181109 AACCCCACTCCGCTTATTTTAGG + Intergenic
944482091 2:200167996-200168018 TGCCCTCCTCCGCTTATTTGAGG - Intergenic
1168876417 20:1175118-1175140 TACCCTACAGCGCCTAGCTCAGG + Intronic
1173277895 20:41600404-41600426 TACCCTACTCCGCTTAGTTCTGG - Intronic
1182464092 22:30503747-30503769 GATCCTCCTCCGCTCAGTTCCGG - Exonic
951065627 3:18261921-18261943 TACCTTACTCCCTTTATTTCAGG - Intronic
967434670 3:189430622-189430644 TCCCCCTCTCCCCTTAGTTCTGG - Intergenic
969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG + Intergenic
969567590 4:7987947-7987969 TCCCCTACGCCGCTCAGTGCAGG + Intronic
972493617 4:39611965-39611987 TCCCCTTCTCCCCTTAGCTCAGG - Intronic
982344023 4:154336058-154336080 TACCCTACACGGTCTAGTTCAGG - Intronic
983359752 4:166713015-166713037 TATCCTACGCCTCTTAGCTCTGG - Intergenic
1004430562 6:15538744-15538766 CACCCTGCTCCGCTGAGTTTGGG + Intronic
1006184526 6:32173432-32173454 GAGCCTACTCCACATAGTTCAGG - Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1012867820 6:104639118-104639140 TCCCCTACTCCTCCTAGTTGAGG + Intergenic
1015241153 6:131025027-131025049 CACTCTACTCTGCTTATTTCAGG + Intronic
1031728325 7:125264735-125264757 TACCCCACTCAGATTAGCTCTGG - Intergenic
1051587294 9:18740223-18740245 TCCCCTAATCCGCTGAGTGCTGG - Intronic
1052829998 9:33207329-33207351 CACCCTACTCCTCTTACATCTGG + Intergenic
1053014425 9:34653911-34653933 TCTCCTACTCCACTCAGTTCTGG - Intronic
1060952876 9:127615429-127615451 TAAACTACTCCTTTTAGTTCTGG - Intronic
1193403612 X:81075960-81075982 TACCCTACTCAACATAGTCCTGG - Intergenic