ID: 1173279671

View in Genome Browser
Species Human (GRCh38)
Location 20:41617815-41617837
Sequence CTGTTTGCAGGGGTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 549}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173279671_1173279679 10 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279679 20:41617848-41617870 CGAATAGAGCAACTTCTCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 34
1173279671_1173279684 19 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279684 20:41617857-41617879 CAACTTCTCCGCGGGGGCGGCGG 0: 1
1: 0
2: 0
3: 13
4: 114
1173279671_1173279685 22 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279685 20:41617860-41617882 CTTCTCCGCGGGGGCGGCGGCGG 0: 1
1: 0
2: 6
3: 46
4: 317
1173279671_1173279681 12 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279681 20:41617850-41617872 AATAGAGCAACTTCTCCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 24
1173279671_1173279686 23 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279686 20:41617861-41617883 TTCTCCGCGGGGGCGGCGGCGGG 0: 1
1: 0
2: 1
3: 34
4: 738
1173279671_1173279680 11 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279680 20:41617849-41617871 GAATAGAGCAACTTCTCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 33
1173279671_1173279683 16 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279683 20:41617854-41617876 GAGCAACTTCTCCGCGGGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 85
1173279671_1173279682 13 Left 1173279671 20:41617815-41617837 CCCTCCTCCACCCCTGCAAACAG 0: 1
1: 0
2: 3
3: 57
4: 549
Right 1173279682 20:41617851-41617873 ATAGAGCAACTTCTCCGCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173279671 Original CRISPR CTGTTTGCAGGGGTGGAGGA GGG (reversed) Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900644715 1:3703718-3703740 CTGTTCTCAGGGATGGAGCAGGG + Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
901195604 1:7438275-7438297 AGGTTTGCGGGGGTGGAGCATGG + Intronic
901635414 1:10668058-10668080 CTGGTCCCAGGGGTGGAGGTGGG + Intronic
902693784 1:18126839-18126861 CTGGTGGTAGGGGTGGAGGATGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904307769 1:29601263-29601285 CTCATTGCAGGGGAGGAGGTAGG - Intergenic
905647037 1:39632271-39632293 CAGTGTGCCGGGGTGGGGGAGGG - Intronic
906098003 1:43237038-43237060 CAGGTGGCAGGGGTGGAGGGTGG + Intronic
907247954 1:53120132-53120154 CCACTTGCAGGGGTGGGGGAAGG + Intronic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
907914926 1:58860078-58860100 CTGCTTAGAGGGGTGGAGAAGGG + Intergenic
908293051 1:62687761-62687783 CCTTTTGTTGGGGTGGAGGAGGG + Intronic
908961178 1:69698583-69698605 CTGGTTGCAGGGGTGAGGAAGGG - Intronic
910713034 1:90201474-90201496 GTCTTTGCAGGGTTGGAGAAAGG + Intergenic
911032695 1:93507166-93507188 TTGTTTGGGGGGGTGGGGGAGGG - Intronic
911086458 1:93981500-93981522 ATGTTGGCAGGGGTGGTGGCTGG + Intergenic
911090023 1:94010857-94010879 CTGTTTGCCATGGTGGTGGAAGG - Exonic
911340866 1:96634675-96634697 CAGTTGGCAGGGGAGGAGGGAGG - Intergenic
912705081 1:111905600-111905622 CTGCTTCCAGAGGTGGAGGCTGG + Intronic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914725729 1:150325801-150325823 CTGTTTGAGGCTGTGGAGGAAGG + Exonic
915556803 1:156665244-156665266 CTGATTGGAGGGGTGGGGGAGGG + Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916390734 1:164328223-164328245 CTATTTGAAGGGTGGGAGGAGGG + Intergenic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
917985659 1:180315622-180315644 CTGAATGTAGGGGTGGAGGTTGG + Intronic
918632600 1:186736052-186736074 ATATTGGCAGGGGTGGATGAAGG - Intergenic
919261714 1:195204429-195204451 CAGTTTAATGGGGTGGAGGAAGG + Intergenic
919749538 1:201028352-201028374 GTGTTTACAGGGGAGGAGGGAGG + Intergenic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920537261 1:206746160-206746182 AAGTTTGCAAGGGTGGAGCATGG - Intergenic
920548215 1:206836418-206836440 GTGTTTTCTGGGGTGGAGGTGGG + Intronic
920685526 1:208106125-208106147 AAGTTGGCAGGGGTGGAGGGGGG + Intronic
921375073 1:214465042-214465064 CTGTTTGGCGGGGTGGGGGGGGG - Intronic
921412476 1:214850525-214850547 GTGTTGGGAGGGATGGAGGAGGG - Intergenic
922336983 1:224625696-224625718 GTGGTTGAAGGTGTGGAGGAGGG + Intronic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
923642249 1:235775888-235775910 ATTTTTGTAGGGGAGGAGGAAGG + Intronic
923670020 1:236032427-236032449 ATGTTTGCAGTGGAGCAGGACGG - Exonic
923712302 1:236396961-236396983 ATGATTGCAGGGGTGGGGGGTGG + Intronic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
1063325282 10:5094345-5094367 CAGTTTGCAGGGGTGGGGGGAGG + Exonic
1063361966 10:5466665-5466687 CAGTTTCCAGGCGTGGAGGGAGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1064209378 10:13349681-13349703 CAGTTTGCGGGGGTGGGGGGTGG + Intergenic
1065617331 10:27541829-27541851 TTGTTTGCAGGGGTGGGGGTGGG - Exonic
1066013768 10:31217658-31217680 GTCTTTGGAGGGGTGGATGAGGG + Intergenic
1067469074 10:46523306-46523328 CTGTTCACAGGGGTGGGGGTGGG - Intergenic
1068314215 10:55320372-55320394 GTGTTTGCAGTGGTGGTGGTGGG - Intronic
1068853485 10:61771727-61771749 CTGTGTGCAGTGGTGGAGTGGGG + Intergenic
1070126342 10:73625499-73625521 CTGGTTAGAGGGGTGGAGGGAGG - Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1071525494 10:86355684-86355706 CTGTTTACAGGCTGGGAGGAAGG + Intronic
1071528984 10:86374845-86374867 CTGTTTGCTGGTGTCCAGGAGGG - Intergenic
1071682379 10:87719012-87719034 CTGTTTGCAGAGGTAGATGGTGG - Intronic
1072068188 10:91890540-91890562 TTTTTTGCAGGGGTGGAGGCAGG - Intergenic
1072758461 10:98036592-98036614 GTGTGAGGAGGGGTGGAGGAGGG + Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1074337445 10:112592370-112592392 CTGTTAGCAATGGTGGGGGAAGG - Intronic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074522750 10:114239889-114239911 CCGGGTACAGGGGTGGAGGAGGG + Intronic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1074711378 10:116180792-116180814 TTATTTGGAGGGGTGGTGGAGGG - Intronic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075483661 10:122802513-122802535 TTGGTTGCAGGGGTGGGGGGTGG + Intergenic
1075888271 10:125921889-125921911 TTCTTTGCAGGGGTGGTGGAAGG - Intronic
1075988612 10:126813012-126813034 TTGCTTGCAGGGGTGGGGGTAGG + Intergenic
1076112742 10:127873339-127873361 CTGTTTGCAGGGTTTGGGGCAGG + Intergenic
1076360310 10:129883741-129883763 GTGGTTGCTGGGGTGGGGGAGGG + Intronic
1076607208 10:131696761-131696783 TGGATTGTAGGGGTGGAGGACGG + Intergenic
1076607270 10:131697054-131697076 TGGATTGTAGGGGTGGAGGATGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076855581 10:133114121-133114143 CTGTTCCCAGGGGTGGAGAAGGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1077540120 11:3142737-3142759 TCGTGTGCAGGGGTGGAGGCTGG + Intronic
1077662679 11:4083508-4083530 CTCTTTGCGGGGATGAAGGAAGG + Intronic
1078472547 11:11603248-11603270 CTGTTTACAGCCTTGGAGGACGG - Intronic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1080789616 11:35510463-35510485 CTGTTTCCGGGGGTGGGGGCGGG - Intronic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1081862078 11:46339077-46339099 CCCTCTGCAGGGGTGGAGAAGGG - Intronic
1081947723 11:47013396-47013418 CTGTTAGGAGGGGTGCAGGAGGG - Intronic
1081981123 11:47268017-47268039 TTCTCTGCAGGTGTGGAGGAGGG + Exonic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083207638 11:61161981-61162003 CTGTTTCCAGGGGGGAAGGGAGG - Intergenic
1083725799 11:64627367-64627389 GTGTCTGCAGGGGAGGAGAAAGG - Intronic
1084067936 11:66716043-66716065 CAGTTGGCAGGGGTGGGGGATGG + Intronic
1084543744 11:69803353-69803375 CAGATTGCAGGGCTGAAGGAAGG - Intergenic
1084963291 11:72728964-72728986 CTGGAAGCAGGGGTGGAGGGCGG + Intronic
1085064724 11:73483691-73483713 CTGTATGCAGGGCTTGAAGAGGG + Intronic
1085404725 11:76255007-76255029 GTGTGTGCAGGGGTGGGGGTGGG + Intergenic
1086392078 11:86375291-86375313 CTGCTTGCAGGGGAGGCGGGGGG + Intronic
1087083359 11:94193430-94193452 CAGATTGCAGGCTTGGAGGAAGG - Intergenic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089679481 11:120111335-120111357 CAGCTTGCAGGGGTTGGGGAGGG - Exonic
1090053504 11:123401651-123401673 GTGGTGGCAGGGGTGGGGGAAGG + Intergenic
1090644389 11:128755950-128755972 CTGTCCGCTGGGGTGGAGAATGG + Intronic
1090691070 11:129182678-129182700 CTATTTCCAGGGCTGGAGGGCGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1090931370 11:131300684-131300706 ATGTTGGAAGGGGAGGAGGAGGG - Intergenic
1090946264 11:131431930-131431952 CTGTTTGGAGTGGTAGAGGGAGG + Intronic
1091164620 11:133464095-133464117 TTGTGTGCAGGTGTGCAGGATGG - Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092030191 12:5277410-5277432 CTGATTTCAGGGGAGGAGGAGGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092659801 12:10725701-10725723 CTGTTGGAAGGGCTGAAGGAGGG + Intergenic
1093124168 12:15307857-15307879 CCACTTCCAGGGGTGGAGGAGGG + Intronic
1093242846 12:16698859-16698881 CTGTTGGAAAGGGTGGAGGTGGG + Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1095205773 12:39439059-39439081 CTGAGTGCATGGGTGTAGGAAGG - Intronic
1096374276 12:51095188-51095210 CCGTTTTCAGAGGTGAAGGAAGG + Exonic
1096497616 12:52047543-52047565 ATGCTTGCAGGGGTGGGAGATGG - Intronic
1096834253 12:54338860-54338882 CTGTTTGCGGGGGCAGAGGAGGG - Intronic
1097291294 12:57917840-57917862 CTGTTTTCATGGCTAGAGGAGGG + Intergenic
1098463685 12:70762945-70762967 CTGTTTGCAAGGGTGAAGGAGGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1100252881 12:92848266-92848288 CTGTTTGCAGGAGGAGACGATGG + Intronic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1102985786 12:117277480-117277502 CTACTTGCAGGGGTTGAGGTGGG + Intronic
1103081191 12:118025227-118025249 CAGCTTCCAGGGGAGGAGGATGG - Intronic
1103188019 12:118978556-118978578 TTGCTTGGTGGGGTGGAGGATGG - Intergenic
1103953826 12:124566147-124566169 CTTTTTGCAGATTTGGAGGAAGG - Intronic
1105220274 13:18319484-18319506 TTCTTTGCAGGGGTGGTGGGAGG + Intergenic
1106119338 13:26845993-26846015 GTGGTTGCAGGGGTTGGGGAAGG - Intergenic
1106187717 13:27423970-27423992 CAGTTTGCCGGGGTGGGGAAGGG + Intergenic
1108495932 13:51025476-51025498 CTCTGTGCAAGGGTGGAGGCGGG - Intergenic
1108500464 13:51065612-51065634 CCGTTTGCTGTGTTGGAGGATGG + Intergenic
1111369726 13:87301472-87301494 TTGTTTCCAGGGGTGGGGGGAGG + Intergenic
1111747515 13:92289285-92289307 CTGTTGGCAGGGGTGGGGGTTGG - Intronic
1112371527 13:98798081-98798103 CTGCTTGCAAGGGTGGTGCAGGG - Intronic
1112520610 13:100091623-100091645 AGGTTTGCAGAGGTGGAGGGAGG - Intronic
1112562412 13:100526228-100526250 CTGTTTGCAGGGGGATGGGAGGG - Intronic
1112676490 13:101708008-101708030 GTGTTTGCATGTGTGTAGGATGG - Intronic
1112682776 13:101786393-101786415 ATGGTTGGAGGGGTGGAGGACGG + Intronic
1113241992 13:108348117-108348139 CTCTTTGCAGGGGTTGGGGGCGG + Intergenic
1113433567 13:110270893-110270915 CTGATTTCAGGGGTGGGGCAGGG + Intronic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1114365940 14:22027137-22027159 GTGTCTGCAGTGGTGGATGAGGG - Intergenic
1114447924 14:22803794-22803816 GTGCTTGCAGGGGTGGAGAGTGG - Intronic
1114642519 14:24232943-24232965 CTCTTTGCAGGGGTAGAAGAAGG + Exonic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115641238 14:35336920-35336942 CTGTGAGGAAGGGTGGAGGAGGG + Intergenic
1117351840 14:54888968-54888990 CTGTTTACTGTGGTGGAGGAGGG + Intronic
1117547701 14:56806798-56806820 CTCTTTGCTGGGGTGGAGGCGGG - Intronic
1118157754 14:63257671-63257693 ATATTTGCAGGGGAGAAGGATGG - Intronic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119221909 14:72915606-72915628 CTGTTTCCAGGGCTAGAGCAGGG - Intergenic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1119733501 14:76966105-76966127 GTGTGTGTTGGGGTGGAGGATGG + Intergenic
1120828394 14:88975629-88975651 CTGTTTCCAGGGTTGGAACAGGG + Intergenic
1120844676 14:89115568-89115590 GGGTTGGCAGGGATGGAGGATGG - Intergenic
1121326667 14:93024183-93024205 CTGTTGCCAGGCCTGGAGGAAGG + Intronic
1121794920 14:96726758-96726780 CTGTGTGTAGTGGTAGAGGATGG + Intergenic
1122084978 14:99293865-99293887 CTGATTCCAGGGCTGGAGCAAGG + Intergenic
1122391952 14:101395536-101395558 CTGTATGCCAGGGTGGAGGCTGG - Intergenic
1122637926 14:103138879-103138901 CTGTGAGCAGGGGTGGAGCGGGG + Intergenic
1122861918 14:104586628-104586650 CTGATTCCTGGGGTGGAGGATGG - Intronic
1122957592 14:105078251-105078273 GTGGTTGCAGGGGTTGGGGATGG - Intergenic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1202869875 14_GL000225v1_random:152133-152155 TTCTTTGCAGGGGTGGTGGGAGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124059677 15:26278299-26278321 TGGTTTCCAGGGCTGGAGGAAGG - Intergenic
1124586470 15:31014262-31014284 TAGTTAGAAGGGGTGGAGGAAGG - Intronic
1126456602 15:48869246-48869268 CTGTTTTCAGGGCTGACGGATGG + Intronic
1126779079 15:52123321-52123343 CTGGATGCAGGGGTGGGGGAGGG - Intronic
1127321826 15:57854459-57854481 CTGATTGCAGGTTTGGGGGAAGG - Intergenic
1127772542 15:62243227-62243249 ATCTCTGCAGGGGTGGAGGTGGG - Intergenic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1130682492 15:86008876-86008898 CTGTTGGCAGGTGGGGAGAAAGG + Intergenic
1130900560 15:88204028-88204050 CTGTTGGCAGGTGGGGAGAAAGG - Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131313157 15:91309086-91309108 TAGTTGGCAGGGGCGGAGGAGGG - Intergenic
1131532078 15:93202343-93202365 CTGGTTTTAGGGGTGGAGCAAGG - Intergenic
1131549150 15:93341762-93341784 CTGGTTGGAGTGGAGGAGGAAGG - Intergenic
1131600838 15:93847162-93847184 CTGTTTGTGGGGTTGGGGGAGGG + Intergenic
1132228532 15:100164121-100164143 TGGAGTGCAGGGGTGGAGGAGGG - Intronic
1132627280 16:897485-897507 GTGTTTACAGGTGGGGAGGAAGG - Intronic
1132631059 16:917685-917707 CTGTTTGCAGGGGTGCTGGGAGG + Intronic
1132699113 16:1214794-1214816 CTGTATGCTGGGCTGGAGGAGGG + Intronic
1132984618 16:2758255-2758277 CTGCTTGGAGAGGTGGAGGCAGG + Intronic
1133180533 16:4050869-4050891 CTGATTCCAGGGCTGGAGCAAGG + Intronic
1133763725 16:8820896-8820918 CTGTTGGAAGGTGTGTAGGAAGG - Intronic
1134014656 16:10879624-10879646 TTGTTGGGAGGGGTGGGGGAGGG + Intronic
1134319607 16:13150710-13150732 CTGCTTGCAGGGGTGGTGGGAGG - Intronic
1134427441 16:14164447-14164469 GTGTGTGCGGGGGTGGGGGATGG + Intronic
1134641198 16:15830534-15830556 CATTTTGGAGGGGTGCAGGAGGG + Intronic
1134848560 16:17461498-17461520 CTAACTGCAGGAGTGGAGGATGG + Intronic
1135700817 16:24630925-24630947 CTGTTTGCTGGGGTGGAGGTGGG + Intergenic
1136683467 16:31981178-31981200 CTGTTTACAGGTGTAGAGGGTGG + Intergenic
1138657689 16:58500445-58500467 CTGTTTGCAGGAGTGGCTGGGGG + Intronic
1138696909 16:58822685-58822707 CTTTTGGCAGGGTAGGAGGAGGG - Intergenic
1138765237 16:59594486-59594508 CTGGTTGTAGGGGTGGGGTAGGG - Intergenic
1139579195 16:67862132-67862154 GTGTTTGTAGGGGAGGAGCATGG + Intronic
1140510990 16:75508457-75508479 CTTTTTTCATTGGTGGAGGAAGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1141648669 16:85380754-85380776 CTGTTTGCGAGGCTGGATGATGG - Intergenic
1141927595 16:87179338-87179360 CTGTTTGTGGGGGTGGGGCAGGG - Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143527243 17:7479656-7479678 CTGTTTCCGGGGGTGGGGGTGGG - Intronic
1144097696 17:11916833-11916855 CATTTTTCGGGGGTGGAGGAAGG - Intronic
1144125050 17:12195711-12195733 CTGGTGGCAGGGCAGGAGGAAGG - Intergenic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1144346381 17:14353519-14353541 ATGGTGGGAGGGGTGGAGGACGG + Intergenic
1144847846 17:18229315-18229337 CTGTTGGCAGGTGGGGAGGTGGG + Intronic
1145779118 17:27550413-27550435 CTGTTTGCAGGGGAGGGGAAAGG - Intronic
1145818437 17:27812259-27812281 CAGTTTGCAGGCATTGAGGAAGG + Intronic
1146212307 17:30952142-30952164 ATGTTTCCAGGGGTTGATGATGG - Intronic
1146966185 17:37032468-37032490 CTGATTTCAGGGCTGGAAGATGG - Intronic
1147034742 17:37671592-37671614 GTGTTTGCAGAGGAGGAGCAGGG - Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147182840 17:38697575-38697597 ATGTCTGTAGGGGTGGAGAAGGG - Intergenic
1147310192 17:39591452-39591474 TTGGCTGCATGGGTGGAGGAAGG + Intergenic
1147529826 17:41265357-41265379 ATGTTGTCAGGGGTGGAGGGTGG - Exonic
1147656875 17:42096179-42096201 CTATTTGCAGGGGCTGTGGATGG - Intergenic
1148158936 17:45439148-45439170 GTGTATGCATGGGTTGAGGAGGG - Intronic
1148218771 17:45848386-45848408 GGGTTTGGAGGGGTGGAAGAGGG - Intergenic
1148274235 17:46289292-46289314 CTATTTGAAGGGGTTGAGGCAGG - Intronic
1148500391 17:48086214-48086236 CTCAGTGCAGGGGTGGAGGGTGG - Intronic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148772005 17:50072720-50072742 GTGATTGCAGGGATGGAGCAAGG + Intronic
1149272184 17:54991941-54991963 GTGTTTGCAGTGGTGGGGGAGGG - Intronic
1149408316 17:56377753-56377775 CTCCTTGCAGGGTTGGGGGATGG + Intronic
1149457101 17:56797033-56797055 CTGTTGGGAGGAGTGGGGGAAGG - Intronic
1149511854 17:57248730-57248752 GTCTTTGCAGGGGTTGAGGGTGG + Intergenic
1149681215 17:58508605-58508627 CAATGTGCAGGAGTGGAGGAGGG + Intronic
1150017580 17:61573772-61573794 CTATTGGAAGGGATGGAGGAAGG - Intergenic
1150390290 17:64786237-64786259 GTGTATGCATGGGTTGAGGAGGG - Intergenic
1151035734 17:70797018-70797040 CTGGTTGCAGGAGGGGTGGAAGG + Intergenic
1151337788 17:73450261-73450283 CTCTGTGCAGGGGTGGAAGCAGG + Intronic
1151829960 17:76543654-76543676 CAGTTTGCAGGGGTTGGGGGTGG + Intronic
1151843890 17:76637442-76637464 GTGTTTCTAGGGGTTGAGGAGGG - Intronic
1151882707 17:76904627-76904649 CTGTTTGCAGGGCAGGTGGGGGG + Intronic
1152392587 17:80011488-80011510 CTGTTAGGAGGGATGGAGGCTGG + Intronic
1152566326 17:81102002-81102024 CTGCCTGCAGGGATGGAGGGCGG + Intronic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1152943014 17:83182259-83182281 CTGTTTGCTGGGATGGGTGAGGG + Intergenic
1153037227 18:774934-774956 CTGTTTGAAGGAGAGCAGGAAGG - Intronic
1153198212 18:2624094-2624116 CTGATTCCAGGGGTGGGGCATGG - Intergenic
1153661401 18:7329355-7329377 CTCTTTGCAAGCTTGGAGGAGGG - Intergenic
1153786214 18:8537541-8537563 CTGGGGGCAGGGGTAGAGGAGGG - Intergenic
1154250547 18:12740486-12740508 TTGTTGGCAGGGGTTGGGGAGGG - Intergenic
1154284497 18:13039533-13039555 CTGTGTGCAGGCCTGGAGGTAGG + Intronic
1155400882 18:25437816-25437838 CTGTATCCAGGGCTGGAGAATGG - Intergenic
1155520491 18:26663446-26663468 ATTTTTTCAGGGGTGGAGCAGGG - Intergenic
1156036229 18:32770623-32770645 CTGTCTGCCAGGTTGGAGGAGGG - Exonic
1157687379 18:49653100-49653122 CTGGATGCAGGGGAGGTGGAAGG - Intergenic
1157730680 18:50001561-50001583 ATGTTTGCAGGTGTCGGGGAGGG - Intronic
1158233007 18:55279580-55279602 CTGGTTGCTGGTTTGGAGGAAGG + Exonic
1159009056 18:63040960-63040982 CAGTTTGCTGGGGTGGAAGGAGG + Intergenic
1159134138 18:64317194-64317216 CTGTTGTCAGGGGAGGGGGAGGG - Intergenic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1159395762 18:67853806-67853828 TTCTTTGCAGGGTTGCAGGATGG + Intergenic
1159899912 18:74036421-74036443 CTGATGGCAGGGATGGAGGCAGG - Intergenic
1159915480 18:74183723-74183745 CTGTCTGGAGGGGTGGAGAATGG + Intergenic
1159980531 18:74773942-74773964 CTGATTGCAGGTCTGGAGCATGG + Intronic
1160147811 18:76378982-76379004 CTGTTTGATGGAGTGTAGGACGG + Exonic
1160363880 18:78307965-78307987 CTCTCTGCAGGTGTCGAGGAAGG + Intergenic
1160507918 18:79437509-79437531 CTGGTTGCAGGGGAGGCTGAGGG + Intronic
1160541725 18:79627563-79627585 CACTCTGCTGGGGTGGAGGAAGG + Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1161732360 19:5969101-5969123 ATGTTTGGAGGGGAGGAGAACGG + Intronic
1161903197 19:7135165-7135187 CTGGTGGCAGGGGTGGGGGCAGG + Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162742899 19:12783341-12783363 AGGTTTGCAGGGGTGGGGGTGGG - Intronic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
1162925575 19:13929361-13929383 CTGATCTAAGGGGTGGAGGAAGG - Exonic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1163364437 19:16868298-16868320 CGCCTTGCAGGGGAGGAGGAAGG + Intronic
1163562560 19:18028836-18028858 CTTTTTGTAAGGATGGAGGAGGG - Intergenic
1165159298 19:33806439-33806461 CTGTTGGCCGGGGTGTTGGATGG + Intronic
1165476388 19:36033107-36033129 TGGTTTGCAGGCGTGGGGGAAGG - Intronic
1165729520 19:38135732-38135754 CCGTTTGCAGGGGTGGGCGTGGG + Intronic
1166220798 19:41363349-41363371 CTGCGTTAAGGGGTGGAGGAAGG + Intronic
1167420415 19:49399374-49399396 GTGTTTTCAGGGGTGGGAGAAGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1168266811 19:55227870-55227892 CTGTATGCCTGTGTGGAGGAAGG - Intronic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926990640 2:18676458-18676480 CTGTCTGCAGTGGTGGGTGAGGG + Intergenic
927632604 2:24787435-24787457 CTGATTGGAGGGTGGGAGGAGGG - Intergenic
927809950 2:26175290-26175312 CGGTTTCCAGGGGAGCAGGAGGG - Intronic
928396908 2:30949620-30949642 CTGATGGCAGGGGTGGTAGATGG - Intronic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929547369 2:42864371-42864393 GTGCTTGCAGGGCTGGGGGAAGG - Intergenic
930086558 2:47501776-47501798 GTCTTTGAAGGGGTGGAGGTGGG + Intronic
930810177 2:55531899-55531921 CTATTAGCAAGGGAGGAGGAGGG + Intronic
931222631 2:60301946-60301968 CTGGTTGCAGGAGTACAGGACGG + Intergenic
931363589 2:61599511-61599533 CATTTTGCAGGGGAGGGGGAGGG - Intergenic
932232366 2:70093462-70093484 CAGTTTGCAGGAGGAGAGGAGGG + Intergenic
932455060 2:71844249-71844271 AGGGATGCAGGGGTGGAGGAAGG - Intergenic
932510418 2:72282062-72282084 TTGTTGGCAGGGGGTGAGGAGGG - Intronic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
934731455 2:96661261-96661283 CTGGTTTCAGGGGAGAAGGAAGG + Intergenic
934768071 2:96891755-96891777 TTATTTGCAGGGCTGGAGGAGGG + Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
935078817 2:99772084-99772106 TTGTTTTCTGAGGTGGAGGATGG - Intronic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
936463812 2:112729679-112729701 CTGGTTGCAGGAGAGGAGGCAGG - Exonic
937015541 2:118602098-118602120 CTGTCTGTGAGGGTGGAGGAAGG + Intergenic
937128047 2:119486863-119486885 CTGTGGGCAGCCGTGGAGGATGG + Intronic
937306789 2:120876631-120876653 CAGCTGGCAGGGTTGGAGGAGGG + Intronic
937362516 2:121238948-121238970 CTGGCAGCAGGGGTGGAGGCAGG - Intronic
937443954 2:121940899-121940921 CTGTATCCCGGGGTGAAGGAAGG + Intergenic
937470719 2:122171863-122171885 CTGATTTCAGTGGGGGAGGACGG + Intergenic
937905407 2:127050559-127050581 CTCTGTGCAGGGCTGGAGGTGGG - Intronic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
939800297 2:146699727-146699749 CTGCTGCCAGGGGTGGGGGAAGG - Intergenic
940883709 2:158970138-158970160 GTGTTTGGAGGGGTGGGGGTGGG + Intronic
941269587 2:163408642-163408664 GGGTTTGGAGGGGTGGGGGAGGG + Intergenic
942970832 2:181956046-181956068 CTGTGGGCAGGGGTGGCGGCGGG - Intronic
944447378 2:199805196-199805218 GAGGCTGCAGGGGTGGAGGATGG - Intronic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946132711 2:217619663-217619685 CAGTTAGCAGGGTGGGAGGATGG + Intronic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
946415668 2:219538553-219538575 CTCTTGGCAGGGGGAGAGGATGG + Exonic
947101622 2:226627329-226627351 CAGCTTTCAGTGGTGGAGGAGGG + Intergenic
947758684 2:232587873-232587895 CTGACTGAAAGGGTGGAGGATGG - Intergenic
947854475 2:233313890-233313912 CTGTTTGCTAGGGTGTAGGCAGG + Intronic
948254927 2:236560247-236560269 CTGTTGGCAGGGGTGCAAAATGG - Intergenic
948674648 2:239589745-239589767 CTATTGGCAGGGATGGAGGTAGG + Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
1168935529 20:1662030-1662052 CTTTTTGCAGGGGTTGTGCAGGG - Intergenic
1168971157 20:1931723-1931745 CAGGTTGCAGGGCTGGTGGAGGG + Intronic
1169207742 20:3749622-3749644 CTGTCTGCAGGGTCGGGGGAGGG - Intronic
1169221291 20:3824566-3824588 CGGCTGGCAGGGATGGAGGAAGG - Exonic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1170472922 20:16685989-16686011 CTCTTTGCTGGGCTCGAGGATGG + Intergenic
1171293804 20:23998906-23998928 GTTTTCTCAGGGGTGGAGGAGGG - Intergenic
1173042210 20:39475130-39475152 CTGTGAGGAGGTGTGGAGGAGGG + Intergenic
1173168357 20:40701914-40701936 ATATGTGCAGGGGTGGAGTAAGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1174079492 20:47960874-47960896 CAGGTTGCAGGGATGCAGGAAGG - Intergenic
1175065291 20:56279376-56279398 CTGATTTCAGGGCTGGAGCAGGG + Intergenic
1175388041 20:58609686-58609708 CTCCTTGCAGGGGTGAAGAATGG + Intergenic
1175787127 20:61718756-61718778 GTGTGTGCAGGGGTGTAGGGTGG - Exonic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175829342 20:61953562-61953584 TGGTTGGCAGGGGTGAAGGATGG + Intronic
1175934691 20:62509448-62509470 GTGGCTGGAGGGGTGGAGGATGG - Intergenic
1175934718 20:62509516-62509538 AGGTGTGGAGGGGTGGAGGATGG - Intergenic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1177038101 21:16070590-16070612 CTTTTTGCAAGGGGGGTGGAGGG + Intergenic
1177597804 21:23267994-23268016 CTATTTGCAGGGGTGGGGATGGG - Intergenic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1178615195 21:34126940-34126962 CTGTGTGCAGTGGTGGGGGTTGG + Intronic
1178699569 21:34821492-34821514 CGGTTTGCAGAGGGGGAGAAGGG + Intronic
1179635947 21:42709296-42709318 CTGTTGGGAGGGTTGGGGGAGGG + Intronic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181942504 22:26489364-26489386 GTGTTCGGAGGGATGGAGGAAGG + Intronic
1182280125 22:29213681-29213703 CTTTTTGCAGGGGTTGGGGAAGG + Intronic
1182292615 22:29293054-29293076 CTGTCCCTAGGGGTGGAGGAGGG - Intronic
1182557954 22:31139235-31139257 TTGTGTGCAGGGTTGGGGGAGGG - Intronic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1182906433 22:33941511-33941533 CTGTTTGCGGGTGGGGAGAAAGG - Intergenic
1183755022 22:39753987-39754009 GTGGTTGAAGGGGTGGAGAATGG - Intronic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184432294 22:44448577-44448599 CTGTTGGCTGGGGTGGAGATGGG + Intergenic
1185286991 22:50006039-50006061 TGCTTTACAGGGGTGGAGGATGG + Intronic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
949558068 3:5176202-5176224 ATGTTTGCAGGCGGGGTGGAAGG - Intronic
950087996 3:10274595-10274617 CTGTGTGTAGGGGTCGGGGAGGG + Intronic
950321845 3:12063058-12063080 GTGTTTGCCGGGGGGAAGGATGG + Intronic
950654574 3:14428636-14428658 CTGTGTGCAGGTGTGTGGGAGGG + Intronic
951138037 3:19127001-19127023 CTGTTTGCATAGGTGGACAAAGG + Intergenic
951732306 3:25823802-25823824 CAGGAAGCAGGGGTGGAGGATGG + Intergenic
952995755 3:38880605-38880627 CTGTTTGTAGGGATAGATGAGGG - Intronic
953906264 3:46869742-46869764 CTGTTGGCATGGGTGGGGAAGGG + Intronic
954122383 3:48507007-48507029 CTGTTTACAGAGCTGTAGGAAGG - Intergenic
954155451 3:48682670-48682692 CTGTAGGCTGGGGTGGAGCATGG - Intronic
954757362 3:52848586-52848608 CTGTTTGTGGGGGTGGTGGGAGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
954903914 3:54043661-54043683 TTGGTGGCAGGGGTGGAAGAAGG + Intergenic
955406759 3:58630610-58630632 CTGTGGGAAGGAGTGGAGGAAGG - Intergenic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
956042748 3:65162790-65162812 CAGTTTCCAAGGGTGGAGCAAGG + Intergenic
956284028 3:67589715-67589737 CTGTGTGCAGGAGAGGTGGATGG + Intronic
956304495 3:67809049-67809071 CAGTTGGCAGGGGTGGGGGTAGG - Intergenic
956391118 3:68773517-68773539 GTGTCTGCATGGGTAGAGGAGGG - Intronic
956463967 3:69500523-69500545 CTACTTGCAGAGGTGTAGGATGG + Intronic
956939468 3:74140187-74140209 CTGCTTGCAGGGGTGTCAGATGG + Intergenic
957677952 3:83394258-83394280 GTTTTTGCAGTGGTGGATGAGGG - Intergenic
958812482 3:98877750-98877772 CTGATTCCAGGGCTGGAGCAGGG + Intronic
959372764 3:105549306-105549328 CTAGTTGCTGGGGTGGAGGAGGG - Intronic
959627808 3:108472292-108472314 CTGTTTCCAGGCTTGGAGAATGG - Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960379391 3:116940383-116940405 ATGTCTGCAGTGGTGGATGAGGG - Intronic
960528894 3:118741533-118741555 CAGCTTGCTGGGGTGAAGGATGG - Intergenic
960943894 3:122952990-122953012 CTGTTTACAAAGGTGTAGGAAGG - Intronic
960991097 3:123311847-123311869 CTGTTTCCTTGGGTGGGGGAGGG - Intronic
961583206 3:127900461-127900483 CTTTTTGGGGGGGTGGAGGAGGG + Intergenic
962126374 3:132624003-132624025 CTTTTTTCGGGGGTGGGGGAGGG - Intronic
962281142 3:134052778-134052800 CTGTGTGAAGCGGTGGAAGAAGG + Intergenic
962936149 3:140082585-140082607 CTGTTTGGAGGGGTGTATGGGGG - Intronic
963228705 3:142888752-142888774 GAGGCTGCAGGGGTGGAGGAAGG + Intronic
963580017 3:147113867-147113889 CAGTTGGCAGAAGTGGAGGAGGG + Intergenic
963789777 3:149572205-149572227 CTTTTTGCAGGGGTTTTGGAAGG + Intronic
963841255 3:150108932-150108954 GTGGTTGCCGGGGTTGAGGAGGG - Intergenic
964198846 3:154094591-154094613 CAGATTCCAGGGCTGGAGGAAGG + Intergenic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
964635874 3:158858408-158858430 ATGTCTGCAGTGGTGGATGAGGG + Intergenic
965929338 3:174023447-174023469 CTGTTTGCAAGGGTGAAGAATGG + Intronic
966060251 3:175745708-175745730 TAGTTTGCAGGGGCAGAGGAAGG + Intronic
966313159 3:178616529-178616551 CTGCTGCCTGGGGTGGAGGAGGG + Intronic
966566216 3:181384304-181384326 CTGGATGCTGGGGTGGAGTAAGG - Intergenic
968711467 4:2122426-2122448 CTGTGTTCAGAGGTAGAGGAGGG + Intronic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969082635 4:4631351-4631373 TGGTTGCCAGGGGTGGAGGATGG - Intergenic
969245810 4:5932051-5932073 CAGTTGGCAGGGGTGGGGGGCGG - Intronic
969523850 4:7694125-7694147 CTGGCTGCAGGGGCAGAGGAAGG + Intronic
969644129 4:8416724-8416746 CTGTGTTCAGGAGTGGACGAGGG - Intronic
970966391 4:21933347-21933369 CTTTTTGCAGGGGTGGAATGGGG + Intronic
971061775 4:22979366-22979388 GTGTCTGCAGTGGTGGATGAGGG - Intergenic
971169605 4:24219646-24219668 ATGTTTGGAGGAGGGGAGGAGGG - Intergenic
973152068 4:46900487-46900509 CTGGTGGCAGGGGAGGAGGGGGG + Intronic
973539918 4:51925507-51925529 ATGTTGGCAGGGGTGGAGAAAGG + Intergenic
974742368 4:66022815-66022837 CTCTTTGCAGGGTGGTAGGAAGG + Intergenic
975290888 4:72677485-72677507 GTGTCTGCAGTGGTGGATGAGGG + Intergenic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
976201574 4:82584770-82584792 GTGTTGGCAGAGGTGGTGGAGGG - Intergenic
976303077 4:83534025-83534047 ATCTTTGCAGTGATGGAGGAGGG - Intergenic
977037714 4:91976151-91976173 CAGTTTGCATGCTTGGAGGAGGG - Intergenic
977935879 4:102804119-102804141 TTTTTTGTAGGGGTGGAGGGCGG + Intronic
979612391 4:122703142-122703164 CTGTTTCCAGAGGAAGAGGAGGG + Intergenic
980623825 4:135345298-135345320 CTGGTGGCAGTGGTGGAGGCAGG - Intergenic
981014210 4:139956646-139956668 CTTTGTGCAGGGGTGGAGTCTGG - Intronic
982199381 4:152945313-152945335 TAGGGTGCAGGGGTGGAGGAAGG - Intronic
983333502 4:166361266-166361288 CTTTTTGTGGGGGTGGGGGAGGG + Intergenic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
986192142 5:5507476-5507498 CTGCTGGCAGGGGTGGAAAATGG + Intergenic
986441574 5:7787189-7787211 CTGTGTGCAGGGGAGGAACAGGG - Intronic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
987691850 5:21277162-21277184 ATGTATGTAGGAGTGGAGGATGG - Intergenic
989420951 5:41239595-41239617 GTGTTTTGAGGGGTGGGGGATGG - Intronic
989511561 5:42293838-42293860 GAGATTGCAGGGTTGGAGGAGGG + Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
989958413 5:50381480-50381502 CTGTTTTGTGGGGTGGGGGAAGG + Intergenic
990154289 5:52857212-52857234 CAGTTTGCAAGGGTGGTCGATGG - Intronic
990638520 5:57756676-57756698 AAGGTTGGAGGGGTGGAGGAAGG + Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991748534 5:69772946-69772968 ATGTATGTAGGAGTGGAGGATGG + Intergenic
991800114 5:70352791-70352813 ATGTATGTAGGAGTGGAGGATGG + Intergenic
991828486 5:70657248-70657270 ATGTATGTAGGAGTGGAGGATGG - Intergenic
991892469 5:71352218-71352240 ATGTATGTAGGAGTGGAGGATGG + Intergenic
992073532 5:73170576-73170598 CTGATTGGAGGGCAGGAGGAGGG + Intergenic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
993868230 5:93219855-93219877 CTGTGTGGAGGGGTGGGGGTGGG - Intergenic
994066751 5:95552298-95552320 CAGTTTGGAGGTTTGGAGGAGGG - Intronic
994371016 5:98967768-98967790 TAGTTTCCAGGAGTGGAGGAAGG + Intergenic
995194997 5:109356909-109356931 ATATGTTCAGGGGTGGAGGAAGG - Intronic
995502690 5:112825157-112825179 CTATTTGCAGGGGATAAGGATGG - Intronic
996207272 5:120756355-120756377 CAGTTTGGAGGTCTGGAGGAAGG - Intergenic
996503755 5:124244720-124244742 GTGTCTGCAGTGGTGGATGAAGG - Intergenic
996844348 5:127882941-127882963 CTGTTTTCAGTGGTGAAAGAAGG - Intergenic
997117959 5:131146181-131146203 CTGATTGCAGGTGTGGGGCAGGG - Intergenic
998740579 5:145196201-145196223 CTGTTTGCAGGGCTTTAAGAAGG - Intergenic
998852514 5:146364437-146364459 CTTTTTGCAGGGAAGGAGGTGGG + Intergenic
999372786 5:151066325-151066347 CTATTTGGAGGGCTGGAGGCTGG - Intronic
1000281984 5:159790063-159790085 CTGTTTGCTGGGGAGGAAGGCGG + Intergenic
1000363354 5:160468204-160468226 TTATTTGCTGGGGTAGAGGAAGG - Intergenic
1000665402 5:163988964-163988986 ATGTTTACAGTAGTGGAGGATGG + Intergenic
1002092770 5:176814577-176814599 CCCTTTGCAGGGGAGGAGGTGGG - Intronic
1002795057 6:465452-465474 CTGTTTGCAGAGGTGAGAGAAGG + Intergenic
1003693558 6:8378832-8378854 TTTTTTACAGGGGTGGAGAAGGG - Intergenic
1004509918 6:16277117-16277139 CTGGTTGCAGGGCGGGGGGAAGG + Intronic
1005492782 6:26361920-26361942 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005496947 6:26396041-26396063 CTGTGGGTAGGGGTGGTGGATGG + Intergenic
1005501718 6:26434517-26434539 CTATGTGTAGGGGTGGTGGATGG + Intergenic
1006106546 6:31720266-31720288 CTGGGGGCAGGGGTGGAGGGTGG + Intronic
1007182918 6:39943422-39943444 CTGTTTGCAGGGGTGTGGTCAGG - Intergenic
1008187492 6:48412023-48412045 GTGCCTGCAGGGGTGGAGAAGGG + Intergenic
1008193305 6:48486806-48486828 CAGTTTCCAAGGATGGAGGAGGG + Intergenic
1008453150 6:51676038-51676060 CTGGTGGCAGAGGAGGAGGAAGG + Intronic
1010289174 6:74115580-74115602 CTGGTGGGAGGGGTGGAGGTCGG + Intergenic
1010872373 6:81058944-81058966 CCGTTTGCACGGGGAGAGGAAGG + Intergenic
1011920809 6:92575311-92575333 ATTTTTTCAGGGGTGGAGGTGGG + Intergenic
1012829638 6:104188134-104188156 GTGTTTGCAGTGGTGGATAAGGG - Intergenic
1015566174 6:134573851-134573873 CTGCTTGCAGGGGACGGGGAAGG + Intergenic
1016472333 6:144387894-144387916 CTGTCTGCTTTGGTGGAGGATGG - Intronic
1017120762 6:151021929-151021951 ATGTTTGCAAGGCTAGAGGAAGG - Intronic
1017308045 6:152942421-152942443 TTTTTGTCAGGGGTGGAGGAGGG + Intergenic
1017799710 6:157883125-157883147 CTTTTTGCTGGGGTGGCGGGGGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018689253 6:166330964-166330986 GTTTTTACAGTGGTGGAGGAGGG - Intronic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1018871882 6:167790124-167790146 TTGAGTGCAGGGGTGGATGACGG - Intronic
1019462080 7:1165409-1165431 CTGACTGCAGGGTTGGAGCAGGG - Intergenic
1019705494 7:2495450-2495472 CTGGAGGCAGGGGTGGAGGCAGG + Intergenic
1020271477 7:6599154-6599176 CTAATTGCTGGGGTGGAGGGAGG + Intronic
1020614065 7:10436947-10436969 GTGTTTGCAGGAATGGAGGTGGG - Intergenic
1020962261 7:14819955-14819977 GTGTTTGCTGGGGCGGAGGGTGG - Intronic
1021931940 7:25589810-25589832 CTGTTTGGGGGTGTGGAGGAAGG - Intergenic
1021937135 7:25642114-25642136 CTGTTTGCAGGTGTGTGGGTTGG - Intergenic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1024016896 7:45325473-45325495 CTGCTGGCAGGGGTGGAGCCAGG + Intergenic
1025032050 7:55565735-55565757 CTGGCTGCAGGGGTGGAGGTGGG + Intronic
1025250410 7:57347855-57347877 GTGTATGCTGGGGTGGATGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027137278 7:75633750-75633772 GTATTTGCTGGGTTGGAGGAGGG - Intronic
1027568726 7:79833842-79833864 CTGTTTCCAGATCTGGAGGAAGG + Intergenic
1028214873 7:88119491-88119513 CTTTTTTCAGGGGTGGGGGATGG + Intronic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1029183735 7:98723307-98723329 TTCTTTGCGGTGGTGGAGGAGGG - Intergenic
1029527009 7:101100825-101100847 CTGTTTCCAAGTGTGAAGGAAGG - Intergenic
1029537174 7:101163612-101163634 CTGTTCGCGGAGGAGGAGGACGG - Exonic
1030805458 7:113912627-113912649 CAGTTAGCAGAAGTGGAGGAAGG + Intronic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031913059 7:127537582-127537604 CTGACTCCAGGGGTGGAGGTGGG - Intergenic
1032265631 7:130368214-130368236 CTTTTTGCAGGAGTAGAGAATGG + Intronic
1032320008 7:130877326-130877348 CTGTTGGCAGGGGTGAGGAAGGG + Intergenic
1032417450 7:131747323-131747345 GTGTATGGAGGGGTGGGGGATGG + Intergenic
1033129421 7:138733226-138733248 CTGTTTGCTGGGGGGGTGGGGGG - Intronic
1033449412 7:141449358-141449380 TTGATTGCAGGGGTGGGGGCAGG + Intronic
1033924067 7:146435310-146435332 CTTTTTGCAGTGGTGGAGAGAGG - Intronic
1034400521 7:150858664-150858686 CTGTTGGATGTGGTGGAGGATGG + Intronic
1035458905 7:159027334-159027356 CTATTGCCACGGGTGGAGGAGGG + Intergenic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036397036 8:8378395-8378417 CTGGTTGCAAGGGAGGAAGAAGG - Intronic
1036409808 8:8489010-8489032 CTGCTGGCTGGGGTGGAGGTAGG - Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1036760244 8:11503720-11503742 CTATGTGCAGGTGTGGAGGATGG + Intronic
1038520578 8:28228994-28229016 CTGGTTGCGGGGGTGGTGGCGGG - Intergenic
1040472282 8:47744168-47744190 CCCTTGGCAGGGGTGGAGGGTGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1042032404 8:64490716-64490738 CTTTTTGCAGGGGATGAGCAAGG + Intergenic
1043427586 8:80163442-80163464 CTGTTACCAGGGGTAGGGGATGG + Intronic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045108339 8:98915771-98915793 GTGTGTGGAGGGGCGGAGGATGG - Intronic
1045775512 8:105797801-105797823 CTGATGGCAGGAGTGGAGGGAGG - Intronic
1048021966 8:130547591-130547613 CTGTTAGCAGGGGTGGGAGGAGG - Intergenic
1048927492 8:139284071-139284093 CTGCTTGCAGAGGTGCAGGGCGG - Intergenic
1049043450 8:140129990-140130012 CTGATTGCAGGGCTGGAGCAGGG + Intronic
1049565386 8:143335310-143335332 CTGTTTGTAGGGGATGAGGTAGG - Intronic
1049756183 8:144312198-144312220 CACTTTTCAGGGGTGGAGGTGGG - Exonic
1049865802 8:144934647-144934669 GTCTTGGCAGGGGTGGAGGATGG - Intronic
1051286387 9:15501779-15501801 GTATCTGCAGGGGTCGAGGAAGG - Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1052563715 9:30118706-30118728 GAGTTTTCAGGGGTGGAGAAGGG + Intergenic
1056235633 9:84591096-84591118 ATTTTTCCAGGGGTGGGGGAAGG - Intergenic
1056383235 9:86074572-86074594 CAGTGTGCAGGGGTGGAGGCTGG + Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1057546514 9:96022945-96022967 CTGTTGGCAGGGGTGAGGGACGG - Intergenic
1057833684 9:98427192-98427214 CTGTTTGTAGGGCTGGAGTGAGG + Intronic
1057879884 9:98785408-98785430 GTGTCTGCAGGTTTGGAGGAGGG - Intronic
1058142466 9:101371874-101371896 CTGTTTCCAGGACTTGAGGAAGG - Intronic
1059236448 9:112764415-112764437 CTTTTGGCCAGGGTGGAGGAGGG + Intronic
1059436791 9:114282000-114282022 CTGGGTGCAGGGGTGGATGGCGG - Intronic
1060087609 9:120715556-120715578 CTGGTTGCAGGGGTTGGGGTGGG + Intergenic
1060550411 9:124482353-124482375 CTGTTTCCAGGAGAGGAGGAAGG + Exonic
1061298807 9:129692565-129692587 GTGGTTGCAGGGCTGCAGGAGGG - Intronic
1061765603 9:132879076-132879098 CTGGAAGCTGGGGTGGAGGATGG + Intronic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062512937 9:136917407-136917429 GAGTCTGCAGGGGTGGAGCAGGG - Intronic
1203734575 Un_GL000216v2:124412-124434 TTCTTTGCAGGGGTGGTGGGAGG - Intergenic
1185432122 X:17476-17498 TGGTTTTCAGGGGTGGAGCATGG - Intergenic
1185441438 X:230190-230212 TGGTTTTCAGGGGTGGAGCATGG - Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1187124363 X:16440011-16440033 CTGTTGGCGGGGGCGGGGGAGGG - Intergenic
1188171968 X:26938589-26938611 CTGTTTGGAGGGCTGGGGGTGGG + Intergenic
1188213942 X:27455077-27455099 CTGCTTGCTGGGGTGAAGCATGG + Intergenic
1188417741 X:29956464-29956486 CTCTGTGCAGGGGTGGGGGCGGG + Exonic
1188450182 X:30300960-30300982 CTGTTTCCAGGGCTGGAGCAAGG + Intergenic
1188641697 X:32513603-32513625 CTGTTTGCAGGGTGAAAGGAAGG + Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1189452871 X:41155811-41155833 CTGTTTCCAGGCGTGGAACAGGG + Intronic
1189693776 X:43642927-43642949 GAGTTGGCATGGGTGGAGGAAGG - Intergenic
1190293200 X:49006951-49006973 CTGATTGCAGGGCTGGGGCAAGG + Intergenic
1191177170 X:57516721-57516743 CTGGTTGCAGCGGTGGTGGAGGG + Intergenic
1192204512 X:69087197-69087219 CTGTCTGCAGGAGTGGGGCAAGG + Intergenic
1192211515 X:69130844-69130866 CTGCTGGCAGGGGTGGTGGTGGG - Intergenic
1192218667 X:69181566-69181588 AAGTTTGAGGGGGTGGAGGATGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192606228 X:72521508-72521530 CTGATTCCAGGGCTGGAGCAGGG + Intronic
1192714888 X:73628650-73628672 CTGTTGTCAGGGTTGGGGGAGGG + Intronic
1192770413 X:74183382-74183404 CTGTTTGTGGGGGTCGAGGGAGG + Intergenic
1192848163 X:74926153-74926175 CTTTTTGAAGGGTTGGATGAAGG + Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195235275 X:102890585-102890607 CTGTGTGCAGAGGTGGGGGTGGG + Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196713177 X:118785132-118785154 CTGTTGGCTGGGCTGGAGTATGG + Intronic
1197009812 X:121546696-121546718 GTGTCTGCAGTGGTGGATGAGGG - Intergenic
1197446495 X:126556243-126556265 CTGTTTGTAGTGGTGGAGGGTGG + Intergenic
1197567861 X:128110996-128111018 ATGTTTGTGGGGGTGGGGGAGGG - Intergenic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198974151 X:142316725-142316747 GTGTTTGCCTGGGTGGGGGAAGG + Intergenic
1201885097 Y:18873522-18873544 CTTTTTCCAGTGGTGGAGGGAGG - Intergenic
1202626455 Y:56864177-56864199 TTCTTTGCAGGGGTGGTGGGAGG + Intergenic