ID: 1173280653

View in Genome Browser
Species Human (GRCh38)
Location 20:41624169-41624191
Sequence ATTGACAGCAAGAGGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173280653_1173280657 1 Left 1173280653 20:41624169-41624191 CCTTGTTCCCTCTTGCTGTCAAT No data
Right 1173280657 20:41624193-41624215 TCCACTCCCACCCCCAGGCCTGG No data
1173280653_1173280659 2 Left 1173280653 20:41624169-41624191 CCTTGTTCCCTCTTGCTGTCAAT No data
Right 1173280659 20:41624194-41624216 CCACTCCCACCCCCAGGCCTGGG No data
1173280653_1173280668 29 Left 1173280653 20:41624169-41624191 CCTTGTTCCCTCTTGCTGTCAAT No data
Right 1173280668 20:41624221-41624243 CATTGATCTGCTTTCTTCTTTGG No data
1173280653_1173280656 -4 Left 1173280653 20:41624169-41624191 CCTTGTTCCCTCTTGCTGTCAAT No data
Right 1173280656 20:41624188-41624210 CAATCTCCACTCCCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173280653 Original CRISPR ATTGACAGCAAGAGGGAACA AGG (reversed) Intergenic
No off target data available for this crispr