ID: 1173281880

View in Genome Browser
Species Human (GRCh38)
Location 20:41635790-41635812
Sequence GGTTATGCCCAGAAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173281880_1173281884 -4 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281884 20:41635809-41635831 AACCAGGAGAAAGGCATATCTGG No data
1173281880_1173281888 27 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281888 20:41635840-41635862 AGACAAAGTCAGTACTGGCATGG No data
1173281880_1173281885 -3 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281885 20:41635810-41635832 ACCAGGAGAAAGGCATATCTGGG No data
1173281880_1173281887 22 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173281880 Original CRISPR GGTTATGCCCAGAAGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr