ID: 1173281884

View in Genome Browser
Species Human (GRCh38)
Location 20:41635809-41635831
Sequence AACCAGGAGAAAGGCATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173281879_1173281884 -3 Left 1173281879 20:41635789-41635811 CCCTCACTCCTTCTGGGCATAAC No data
Right 1173281884 20:41635809-41635831 AACCAGGAGAAAGGCATATCTGG No data
1173281880_1173281884 -4 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281884 20:41635809-41635831 AACCAGGAGAAAGGCATATCTGG No data
1173281876_1173281884 4 Left 1173281876 20:41635782-41635804 CCTATTGCCCTCACTCCTTCTGG No data
Right 1173281884 20:41635809-41635831 AACCAGGAGAAAGGCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173281884 Original CRISPR AACCAGGAGAAAGGCATATC TGG Intergenic
No off target data available for this crispr