ID: 1173281887

View in Genome Browser
Species Human (GRCh38)
Location 20:41635835-41635857
Sequence AATACAGACAAAGTCAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173281879_1173281887 23 Left 1173281879 20:41635789-41635811 CCCTCACTCCTTCTGGGCATAAC No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data
1173281876_1173281887 30 Left 1173281876 20:41635782-41635804 CCTATTGCCCTCACTCCTTCTGG No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data
1173281882_1173281887 15 Left 1173281882 20:41635797-41635819 CCTTCTGGGCATAACCAGGAGAA No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data
1173281886_1173281887 1 Left 1173281886 20:41635811-41635833 CCAGGAGAAAGGCATATCTGGGT No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data
1173281880_1173281887 22 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281887 20:41635835-41635857 AATACAGACAAAGTCAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173281887 Original CRISPR AATACAGACAAAGTCAGTAC TGG Intergenic
No off target data available for this crispr