ID: 1173281888

View in Genome Browser
Species Human (GRCh38)
Location 20:41635840-41635862
Sequence AGACAAAGTCAGTACTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173281880_1173281888 27 Left 1173281880 20:41635790-41635812 CCTCACTCCTTCTGGGCATAACC No data
Right 1173281888 20:41635840-41635862 AGACAAAGTCAGTACTGGCATGG No data
1173281882_1173281888 20 Left 1173281882 20:41635797-41635819 CCTTCTGGGCATAACCAGGAGAA No data
Right 1173281888 20:41635840-41635862 AGACAAAGTCAGTACTGGCATGG No data
1173281879_1173281888 28 Left 1173281879 20:41635789-41635811 CCCTCACTCCTTCTGGGCATAAC No data
Right 1173281888 20:41635840-41635862 AGACAAAGTCAGTACTGGCATGG No data
1173281886_1173281888 6 Left 1173281886 20:41635811-41635833 CCAGGAGAAAGGCATATCTGGGT No data
Right 1173281888 20:41635840-41635862 AGACAAAGTCAGTACTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173281888 Original CRISPR AGACAAAGTCAGTACTGGCA TGG Intergenic
No off target data available for this crispr