ID: 1173284994

View in Genome Browser
Species Human (GRCh38)
Location 20:41662307-41662329
Sequence AATTGCTGCAAACAACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173284994_1173285001 2 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285001 20:41662332-41662354 AATGTGTGGAGAGGGTGGATGGG No data
1173284994_1173284997 -7 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173284997 20:41662323-41662345 AGCAATTCAAATGTGTGGAGAGG No data
1173284994_1173285000 1 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG No data
1173284994_1173285003 13 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285003 20:41662343-41662365 AGGGTGGATGGGGTGATCCAAGG No data
1173284994_1173285002 3 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285002 20:41662333-41662355 ATGTGTGGAGAGGGTGGATGGGG No data
1173284994_1173284998 -6 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173284998 20:41662324-41662346 GCAATTCAAATGTGTGGAGAGGG No data
1173284994_1173285004 18 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285004 20:41662348-41662370 GGATGGGGTGATCCAAGGAAAGG No data
1173284994_1173284999 -3 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173284999 20:41662327-41662349 ATTCAAATGTGTGGAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173284994 Original CRISPR AATTGCTGCAAACAACTTCC GGG (reversed) Intergenic
No off target data available for this crispr