ID: 1173285000

View in Genome Browser
Species Human (GRCh38)
Location 20:41662331-41662353
Sequence AAATGTGTGGAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173284995_1173285000 0 Left 1173284995 20:41662308-41662330 CCGGAAGTTGTTTGCAGCAATTC No data
Right 1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG No data
1173284994_1173285000 1 Left 1173284994 20:41662307-41662329 CCCGGAAGTTGTTTGCAGCAATT No data
Right 1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173285000 Original CRISPR AAATGTGTGGAGAGGGTGGA TGG Intergenic
No off target data available for this crispr