ID: 1173285922

View in Genome Browser
Species Human (GRCh38)
Location 20:41671384-41671406
Sequence ACTTGTTAAGGGCTGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173285918_1173285922 22 Left 1173285918 20:41671339-41671361 CCAGGGAGCAAGAGCTGGAGGAT No data
Right 1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG No data
1173285916_1173285922 25 Left 1173285916 20:41671336-41671358 CCACCAGGGAGCAAGAGCTGGAG No data
Right 1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG No data
1173285912_1173285922 28 Left 1173285912 20:41671333-41671355 CCCCCACCAGGGAGCAAGAGCTG No data
Right 1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG No data
1173285913_1173285922 27 Left 1173285913 20:41671334-41671356 CCCCACCAGGGAGCAAGAGCTGG No data
Right 1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG No data
1173285915_1173285922 26 Left 1173285915 20:41671335-41671357 CCCACCAGGGAGCAAGAGCTGGA No data
Right 1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173285922 Original CRISPR ACTTGTTAAGGGCTGTCCCA GGG Intergenic
No off target data available for this crispr