ID: 1173289074

View in Genome Browser
Species Human (GRCh38)
Location 20:41698636-41698658
Sequence AAACCAGGAGGCAGGATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173289074_1173289084 19 Left 1173289074 20:41698636-41698658 CCAATGATCCTGCCTCCTGGTTT No data
Right 1173289084 20:41698678-41698700 CTCCCATGTAGCAGCAGTAATGG No data
1173289074_1173289078 -8 Left 1173289074 20:41698636-41698658 CCAATGATCCTGCCTCCTGGTTT No data
Right 1173289078 20:41698651-41698673 CCTGGTTTTCAAACCCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173289074 Original CRISPR AAACCAGGAGGCAGGATCAT TGG (reversed) Intergenic
No off target data available for this crispr