ID: 1173290724

View in Genome Browser
Species Human (GRCh38)
Location 20:41712685-41712707
Sequence CTGTGTTTAGGGAAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173290724_1173290730 15 Left 1173290724 20:41712685-41712707 CCAGCCTGCTTCCCTAAACACAG No data
Right 1173290730 20:41712723-41712745 ACTTACTTTCATCTCAAAGGTGG No data
1173290724_1173290729 12 Left 1173290724 20:41712685-41712707 CCAGCCTGCTTCCCTAAACACAG No data
Right 1173290729 20:41712720-41712742 GCTACTTACTTTCATCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173290724 Original CRISPR CTGTGTTTAGGGAAGCAGGC TGG (reversed) Intergenic
No off target data available for this crispr