ID: 1173295998

View in Genome Browser
Species Human (GRCh38)
Location 20:41757911-41757933
Sequence GTGAAAAATCAGATGGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173295995_1173295998 2 Left 1173295995 20:41757886-41757908 CCCATTGCTTGTTTTTGTCAGGT 0: 4181
1: 12566
2: 5478
3: 2083
4: 1483
Right 1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG No data
1173295993_1173295998 7 Left 1173295993 20:41757881-41757903 CCTTTCCCATTGCTTGTTTTTGT 0: 54
1: 172
2: 263
3: 239
4: 841
Right 1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG No data
1173295992_1173295998 8 Left 1173295992 20:41757880-41757902 CCCTTTCCCATTGCTTGTTTTTG 0: 216
1: 4654
2: 12401
3: 5398
4: 3479
Right 1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG No data
1173295996_1173295998 1 Left 1173295996 20:41757887-41757909 CCATTGCTTGTTTTTGTCAGGTT 0: 4280
1: 12602
2: 5328
3: 2020
4: 1596
Right 1173295998 20:41757911-41757933 GTGAAAAATCAGATGGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173295998 Original CRISPR GTGAAAAATCAGATGGTTGT AGG Intergenic
No off target data available for this crispr