ID: 1173300644

View in Genome Browser
Species Human (GRCh38)
Location 20:41799364-41799386
Sequence AGCTGAGTATGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173300638_1173300644 12 Left 1173300638 20:41799329-41799351 CCGCCAGTTGTTTTGGATGGGTC No data
Right 1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG No data
1173300639_1173300644 9 Left 1173300639 20:41799332-41799354 CCAGTTGTTTTGGATGGGTCAAG No data
Right 1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173300644 Original CRISPR AGCTGAGTATGGAGGGAAGC TGG Intergenic
No off target data available for this crispr