ID: 1173306826

View in Genome Browser
Species Human (GRCh38)
Location 20:41858482-41858504
Sequence CTGGGGTGTCCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173306818_1173306826 13 Left 1173306818 20:41858446-41858468 CCAGAAGAAAAACTTTTTGTCTT No data
Right 1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173306826 Original CRISPR CTGGGGTGTCCCAGGGAAGC AGG Intergenic
No off target data available for this crispr