ID: 1173308103

View in Genome Browser
Species Human (GRCh38)
Location 20:41871170-41871192
Sequence GAACAGGTCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173308103_1173308105 -4 Left 1173308103 20:41871170-41871192 CCTCAATTTGCATTGACCTGTTC No data
Right 1173308105 20:41871189-41871211 GTTCCTTAATTTATATGCAATGG No data
1173308103_1173308107 3 Left 1173308103 20:41871170-41871192 CCTCAATTTGCATTGACCTGTTC No data
Right 1173308107 20:41871196-41871218 AATTTATATGCAATGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173308103 Original CRISPR GAACAGGTCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr