ID: 1173310569

View in Genome Browser
Species Human (GRCh38)
Location 20:41892891-41892913
Sequence TCAGTACCACAGATGGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173310569_1173310573 13 Left 1173310569 20:41892891-41892913 CCATAAGCCATCTGTGGTACTGA No data
Right 1173310573 20:41892927-41892949 GCACACCAGATCAAGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173310569 Original CRISPR TCAGTACCACAGATGGCTTA TGG (reversed) Intergenic
No off target data available for this crispr