ID: 1173320220

View in Genome Browser
Species Human (GRCh38)
Location 20:41981019-41981041
Sequence GAGTTGATAGGGGCCTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173320215_1173320220 25 Left 1173320215 20:41980971-41980993 CCACTGGTGTCAGGAAATCAGGT No data
Right 1173320220 20:41981019-41981041 GAGTTGATAGGGGCCTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173320220 Original CRISPR GAGTTGATAGGGGCCTGAAC TGG Intergenic
No off target data available for this crispr