ID: 1173320516

View in Genome Browser
Species Human (GRCh38)
Location 20:41983388-41983410
Sequence CTTTTCAAGGCCATGCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173320516_1173320526 30 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320526 20:41983441-41983463 GGTGAACATCGGGGGAGCCCAGG No data
1173320516_1173320522 20 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320522 20:41983431-41983453 ATTGCTCCTTGGTGAACATCGGG No data
1173320516_1173320523 21 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320523 20:41983432-41983454 TTGCTCCTTGGTGAACATCGGGG No data
1173320516_1173320519 9 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320519 20:41983420-41983442 AAGTCCTGAGTATTGCTCCTTGG No data
1173320516_1173320521 19 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320521 20:41983430-41983452 TATTGCTCCTTGGTGAACATCGG No data
1173320516_1173320524 22 Left 1173320516 20:41983388-41983410 CCAATATGCATGGCCTTGAAAAG No data
Right 1173320524 20:41983433-41983455 TGCTCCTTGGTGAACATCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173320516 Original CRISPR CTTTTCAAGGCCATGCATAT TGG (reversed) Intergenic
No off target data available for this crispr