ID: 1173323519

View in Genome Browser
Species Human (GRCh38)
Location 20:42010746-42010768
Sequence CAAAATGCTGACAGTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173323519_1173323521 4 Left 1173323519 20:42010746-42010768 CCATTATCACTGTCAGCATTTTG No data
Right 1173323521 20:42010773-42010795 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173323519 Original CRISPR CAAAATGCTGACAGTGATAA TGG (reversed) Intergenic
No off target data available for this crispr